Labshake search
Citations for Eppendorf :
301 - 350 of 420 citations for 7 METHYLTHIENO 2 3 B QUINOLINE 2 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... Supplementary Table 5) were incubated together for 2 h at 37 °C under gentle shaking (450 rpm, Eppendorf ThermoMixer® C, Eppendorf AG, Germany). Unbound DNA origami was removed by placing the tube on a magnet and discarding the supernatant ...
-
bioRxiv - Cell Biology 2021Quote: ... of the same volume as the RIPA buffer at 25 °C for 2 h with intermittent mixing (Thermomixer comfort, Eppendorf, Wesseling-Berzdorf, Germany). The digested sample was labelled as the RIPA-insoluble fraction (Ins) ...
-
bioRxiv - Microbiology 2023Quote: ... algal cells with the attached bacteria in the treatment with the species consortium were also collected by a pipette from the formaldehyde-fixed suspended sample and transferred into 2 ml safe-lock tubes (Eppendorf, Wesseling-Berzdorf, Germany). To avoid an excessive fixation ...
-
bioRxiv - Systems Biology 2024Quote: ... placed in a 2mL Protein LoBind® Eppendorf tube and centrifuged at 1000g for 2 minutes at RT (Microcentrifuge 5415, Eppendorf, Hamburg, Germany).
-
bioRxiv - Developmental Biology 2024Quote: ... One- or 2-cell stage embryos were injected with approximately 20 nl of the injection mixture (manually or using an Eppendorf FemtoJet 4x microinjector) and maintained at 20°C until the 64-cell stage ...
-
bioRxiv - Cell Biology 2024Quote: ... and denatured at 85°C for 7 minutes using a ThermoMixer® C-PCR 384 (Eppendorf). After denaturation ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... or double (for qRT-PCR) blastomere microinjections of 2-cell (E1.5) stage embryos were performed using the FemtoJet 4i (Eppendorf, Hamburg, Germany; Cat. No. 5252000013) micro-injector ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were spun down (5 min, 800 g•, 2 °C, minimal acceleration and break, Eppendorf 5810 R with swing-×bucket rotor A-4-44). The medium was discarded and the cells were dissociated in 15 mL of ice cold ACK solution (0.15 M NH4Cl ...
-
bioRxiv - Cell Biology 2020Quote: ... This solution was centrifuged at 3000g for 2 min and the supernatant was collected and concentrated in a vacuum concentrator in vacuum-alcoholic (V-AL) mode (Eppendorf plus, Eppendorf, Hamburg, Germany). The concentrated crystals were resuspended in 100μl of 1 X PBS and Nuclease Free Water (NFW) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were loaded into a microinjection needle and 50 nL of the ZMEL cell suspension was transplanted into the hindbrain ventricle of anesthetized 2 dpf zebrafish larvae by using an oil-controlled microinjection rig (Eppendorf CellTram 4r Oil, #5196000030) with a Narishige arm ...
-
bioRxiv - Bioengineering 2023Quote: ... Transwells® were then incubated at 37 °C and 25 RPM for 2 hrs in a New Brunswich™ Innova® 40 shaker (Eppendorf, Enfield, CT). Samples were collected every hour from the basolateral side ...
-
bioRxiv - Genomics 2024Quote: ... 2 µL sheared DNA was used to perform overnight pulse-field gel electrophoresis while the remaining sheared DNA was stored in a 2 mL DNA LoBind® Tube (Eppendorf Cat. No. 022431048) at 4 °C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... Each flask was aeriated with 2% v/v CO2 enriched air which was controlled by a DASGIP® MX module (Eppendorf AG, Hamburg, Germany). The microalgae starting with an OD750 of 0.1 were cultivated in modified Johnson medium at a pH of 7.5 [49] with 1 M NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... falciparum parasites were cultured in human red blood cells (O+ or B+, Universitätsklinikum Eppendorf, Hamburg, Germany) at 5 % haematocrit in an atmosphere of 1% O2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... complete amino acid supplementation) overnight in 96-well flat bottom plates (Eppendorf), diluted into fresh medium with a dilution factor of 200 ...
-
bioRxiv - Neuroscience 2021Quote: ... starting from 100 ng of total RNA (RIN ≥7) on an epMotion® 5075 TMX workstation (Eppendorf). Library QC included size distribution check (BioAnalyser ...
-
bioRxiv - Molecular Biology 2021Quote: ... Flowrate was adjusted at 2 ml/min to collect peptides in 1 ml fractions in low-protein binding Eppendorf tubes (Eppendorf LoBind tubes, cat. no. EPPE0030108.116). The bound complexes were separated from β2 microglobulin and heavy chain using increasing concentration of buffer B ...
-
bioRxiv - Biochemistry 2020Quote: ... polar phase were transferred into a new 2 mL reaction tube and dried in a vacuum concentrator (Eppendorf, Concentrator plus, mode: V-AQ, 30 °C) for approximately 4.5 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA samples were collected in 2.0 ml nucleic acid LoBind tubes (Eppendorf) and stored at −80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of the lipid-containing lower organic phase was spotted on a MALDI target plate (Prespotted AnchorChip 96 Set for Proteomics II; Bruker Daltonics/Eppendorf; washed peptide-free with 2-propanol) pre-spotted with 1 µl of 9-aminoacridine (10 mg/ml dissolved in acetone:water 9:1 (v/v) ...
-
bioRxiv - Biophysics 2020Quote: ... with three ssDNA overhang strands on a bottom partially complementary to the sequence on the magnetic beads (mag2, Supplementary Table 5) were incubated together for 2 h at 37 °C under gentle shaking (450 rpm, Eppendorf ThermoMixer® C, Eppendorf AG, Germany). Unbound DNA origami was removed by placing the tube on a magnet and discarding the supernatant ...
-
bioRxiv - Molecular Biology 2022Quote: ... falciparum 3D7 (68) were cultured in human red blood cells (O+ or B+, Blood bank, Universitätsklinikum Hamburg-Eppendorf). Cultures were maintained at 37°C in an atmosphere of 1% O2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged Z-B dimers (to 25 nM in 25 µL) in a 1.5-mL LoBind tube (Eppendorf). Then canonical nucleosomes (from native or recombinant source ...
-
bioRxiv - Developmental Biology 2019Quote: ... was injected at a concentration of 40 mM in embryos either at the end of cellularization around 5 min before imaging or at stage 7 during imaging using an InjectMan4 micromanipulator and a FemtoJet 4i microinjector from Eppendorf directly installed on the imaging microscope.
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2021Quote: ... were mixed and injected into the cytoplasm of fertilized eggs in a droplet of HEPES-CZB medium containing 5ug/ml cytochalasin B (CB) using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Developmental Biology 2023Quote: ... were mixed in HEPES-CZB medium containing 5 μg/ml cytochalasin B (CB) and injected into the cytoplasm of fertilized eggs using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Genomics 2024Quote: ... 3uL of SL-B reagent (BioSkryb Genomics, USA) was deposited in each well of a LoBind twin.tec PCR plate (Eppendorf, Germany) prior to sorting ...
-
bioRxiv - Cell Biology 2022Quote: ... Eluted lysates in 60% acetonitrile/0.1% formic acid were dried by vacuum centrifugation (Eppendorf; Concentrator Plus) at 45°C.
-
bioRxiv - Biochemistry 2023Quote: ... in 0.3% acetic acid was added to a 96-well plate (CAT# 0030128664, Eppendorf, Hamburg, Germany), sealed with plate seal (CAT# 5010-21951 ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were kept soaked at 37 °C for up to 7 days on an orbital shaker (Excella E24, Eppendorf, Hamburg, Germany) with an agitation rate of 150 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfected cells were transferred into 8.0 mL of MA2 media in 20 mL culture tubes and allowed to recover while rotating (∼80 rpm) in the outer rim of a tissue culture roller drum (New Brunswick; model TC-7; Eppendorf, USA) housed in an Algatron® incubator (Photon Systems Instruments ...
-
bioRxiv - Biophysics 2023Quote: ... The blood was centrifuged at 250 RCF (relative centrifugal force) and 7 rad/s2 acceleration for 20 min (5810 R, Eppendorf, Hamburg, Germany). The platelet rich plasma (PRP ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Cell Biology 2019Quote: ... Digested peptides were extracted from gels using 50% ACN solution with 2.5% formic acid (FA) and concentrated in speedVac concentrator (Eppendorf). The aliquot (1/10 ...
-
bioRxiv - Cell Biology 2019Quote: ... Digested peptides were extracted from gels using 50% ACN solution with 2.5% formic acid (FA) and concentrated in speedVac concentrator (Eppendorf). The aliquot (1/10 ...
-
bioRxiv - Cell Biology 2023Quote: Peptides were eluted from home-made StageTips using 60% acetonitrile and 0.1% formic acid and evaporated to complete dryness using a SpeedVac (Eppendorf). Peptides were reconstituted in 2% formic acid and 2% acetonitrile ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1% trifluoroacetic acid (TFA) (v/v) and the extracts were reduced to dryness using a centrifugal vacuum concentrator (Eppendorf) and re-suspended in 3 % (v/v ...
-
bioRxiv - Genomics 2023Quote: ... eluted with 2 x 100 μl of 70 % (v/v) acetonitrile in 0.5 % (v/v) trifluoroacetic acid into low-binding microcentrifugation tubes (Protein LoBind, Eppendorf), and vacuum-dried in Vacufuge Concentrator Plus (Eppendorf) ...
-
bioRxiv - Microbiology 2024Quote: ... coli cultures and mixed with resuspended in a 1X lysis buffer / Hot Acid Phenol solution in a 1.5 mL microcentrifuge tube on a thermomixer (Eppendorf) set to 65°C ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...