Labshake search
Citations for Eppendorf :
301 - 350 of 1048 citations for 2 4 Chloro 2 tetradecylphenoxy N 3 5 dichloro 2 hydroxy 4 methylphenyl acetamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and the cells were pelleted by centrifugation at approximately 250 × g for 5 min at 4 °C (Eppendorf 5804 R, Hamburg, Germany). After resuspension ...
-
bioRxiv - Plant Biology 2024Quote: ... The supernatant was collected after centrifugation at 4 °C for 5 min at 5000 g and dried using a SpeedVaq (Eppendorf, Montesson, France). Then ...
-
bioRxiv - Immunology 2024Quote: ... stool suspensions of feces (in H2O) were centrifuged at 16000 rpm and 4°C for 5 min using an Eppendorf 5427R centrifuge (Eppendorf; Hamburg, Germany). 100 µL of supernatant were mixed with 400 µL of ice-cold methanol containing recovery standards for evaluation of the quality of cell harvest and correction for variations ...
-
bioRxiv - Immunology 2024Quote: ... Before preparation for LC-MS analysis each sample was centrifuged at 16000 rpm and 4°C for 5 min using an Eppendorf 5427R centrifuge (Eppendorf; Hamburg, Germany). From each supernatant 350 µL were pipetted into two separate LC vials ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 10 sec (5424-R Eppendorf microfuge) and the pellet was resuspended with 400 μl TES Solution (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 20°C for 4 hours (Thermomixer 5355 R, Eppendorf). After incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in a Realplex 4 Thermocycler (Eppendorf) using the following program ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C for 20 minutes (Eppendorf® 5418 R) to collect all the cells ...
-
bioRxiv - Genetics 2024Quote: ... 000 RPM for 10 minutes at 4°C (Eppendorf), followed by transfer of the plasma to tubes ...
-
bioRxiv - Cell Biology 2020Quote: ... and injected into the nucleus of HeLa or U-2 OS cells using an Eppendorf FemtoJet® Microinjector (Eppendorf). After media were changed ...
-
bioRxiv - Neuroscience 2021Quote: ... The extraction step incorporated a 2-fold concentration of saliva samples using a vacuum concentrator (Concentrator plus, Eppendorf, Germany) resulting in a detection sensitivity of 3pg/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were sorted using a 100 um nozzle (∼20 PSI) into 2 ml protein LoBind Eppendorf tubes (Eppendorf 0030108132) placed in a cooling holder ...
-
bioRxiv - Genomics 2020Quote: ... cultures were diluted to OD ∼ 0.02 in 1.4 mL of LB and were further grown for 2 h at 37°C on a Thermomixer (Eppendorf) with shaking (700 rpm) ...
-
bioRxiv - Biochemistry 2021Quote: ... β-chitin aliquots from the culture flasks were transferred to 2 mL Safe-Lock Eppendorf tubes (Eppendorf, Hamburg, Germany) and boiled directly for 5 min in 30 µL NuPAGE LDS sample buffer and NuPAGE sample reducing agent (Invitrogen™ ...
-
bioRxiv - Systems Biology 2021Quote: ... Cell lysates were transferred to a new tube and were centrifuged for 2 min at full speed (Eppendorf centrifuge) and the supernatant was carefully mixed with 1 volume of 70% HPLC-grade ethanol ...
-
bioRxiv - Immunology 2022Quote: ... incubated with each antigen at certain concentration in PBS/2% FCS and transfer to a 37°C thermomixer (Eppendorf). Cells were collected after each period of incubation and fixed in IC fixation buffer on ice for 30 mins and at RT for additional 30 mins ...
-
bioRxiv - Evolutionary Biology 2020Quote: GV oocytes were microinjected with ~5 pl of cRNAs in M2 medium (with 2.5 mM milrinone and 3mg/mL BSA) at room temperature (RT) with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Immunology 2020Quote: ... 293T-hACE2-FFLuc-GFP-RBD cells were transfected with 0.25 μg of SARS-CoV-2-RBD plasmid and 0.25 μg of pHAGE-FFLuc-GFP each well in a 24-well plate (Eppendorf) for 48 hours at 37°C under 5% (v/v ...
-
Phosphoproteomics of cellular mechanosensing reveals NFATC4 as a regulator of myofibroblast activitybioRxiv - Systems Biology 2023Quote: ... cleared by centrifugation and transferred to a clean 2 ml 96-well deep-well plate (DWP, Eppendorf, Hamburg, Germany). TiO2 beads (Titansphere® Phos-TiO Bulk 10 µm ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein LoBind® microtubes (2 mL) and epT.I.P.S.® pipette tips (1000 µL) were purchased from Eppendorf (Hamburg, Germany).
-
bioRxiv - Genomics 2024Quote: ... The resultant DNA was collected and stored in a 2 mL DNA LoBind® Tube (Eppendorf Cat. No. 022431048) at 4 °C until library preparation ...
-
bioRxiv - Molecular Biology 2022Quote: ... we further purified the extracts by treatment with 1% sodium dodecyl sulfate in NaP-EDTA buffer and centrifugation at 13,000 rpm for 10 min (rotor FA-24×2, Eppendorf). This purification process was repeated two times ...
-
bioRxiv - Cell Biology 2023Quote: ... Oocytes were then microinjected with ~5 pl of mRNAs in M2 medium with 2.5 mM milrinone and 3mg/mL BSA at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Genomics 2022Quote: ... Supernatant was transferred using a wide-bore pipette to a 2 mL DNA low-bind tube (Eppendorf, Enfield CT), precipitated with 1 mL of 100% ethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... The sample was incubated at 25 °C for 2 h with intermittent mixing (Thermomixer comfort, Eppendorf, Wesseling-Berzdorf, Germany) to reduce viscosity ...
-
bioRxiv - Immunology 2024Quote: ... a single mouse kidney was weighed and placed in a 2 mL safelock microcentrifuge tube (#05-402-12, Eppendorf) containing 1 mL kidney extraction buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... and flash frozen in liquid nitrogen as a pellet in a 2 mL Eppendorf Safe-Lock tube (Eppendorf #0030123620) with a 7 mm steel ball (Retsch #05.368.0035) ...
-
bioRxiv - Molecular Biology 2024Quote: ... peptides were eluted in 40 μl of 80% acetonitrile in 0.1% TFA and concentrated down to 2 μl by vacuum centrifugation (Concentrator 5301, Eppendorf). The peptide sample was then prepared for LC-MS/MS analysis by diluting it to 5 μl by 0.1% TFA ...
-
bioRxiv - Systems Biology 2024Quote: ... The volume corresponding to 100 μg protein was transferred to a 96-well 2 ml deep-well plate (Eppendorf) and total volume was adjusted to 200 μl with lysis buffer.
-
bioRxiv - Genomics 2024Quote: ... The supernatant was removed and cells were resuspended in 2×100µl F-buffer in a 1.5mL low binding tube (Eppendorf, 022431021). Cells were counted and Freezing Buffer (F ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). The compensation pressure set on the FemtoJet was 35hPa for the whole injection experiment to avoid damages on cells ...
-
bioRxiv - Biophysics 2022Quote: ... The probe was controlled with a micromanipulator (Injectman 4; Eppendorf) and mounted on an inverted epifluorescent microscope.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Physiology 2023Quote: ... for 1 h at 4 □ on a ThermoMixer C (Eppendorf), 350 µl of water and 250 µl of chloroform were added to the mixture to induce phase separation ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the remaining blood cells from the plasma.
-
bioRxiv - Bioengineering 2024Quote: ... Homogenates were agitated at 4°C in a thermomixer (Eppendorf) for 2 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). Microinjection of cells were performed on an inverted microscope (Nikon Ti2 Eclipse ...
-
bioRxiv - Cell Biology 2024Quote: ... The probe was controlled with a micromanipulator (Injectman 4, Eppendorf), and mounted on an inverted epifluorescence microscope.
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged (Eppendorf 5810R, 3,220 x g, 4 °C, 1 min), and the absorbance was measured at 494 nm (CLARIOstar ...
-
bioRxiv - Genetics 2024Quote: ... in a 96-well Eppendorf Realplex 4 PCR machine (Eppendorf).
-
bioRxiv - Cell Biology 2024Quote: ... 4℃ for 15 min using Eppendorf 5810R Centrifuge (Eppendorf, Germany) with A-4-81 Rotor (Eppendorf ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4°C for 10 minutes using a 5415R microcentrifuge (Eppendorf) and supernatants were transferred ...
-
bioRxiv - Cell Biology 2020Quote: ... the beads were separated from the protein extracts on a magnetic rack and transferred to a new 2 ml LoBind tube (Eppendorf). The beads were washed with 1 ml of each following solution ...
-
bioRxiv - Cell Biology 2020Quote: ... The whole lane was excised from the gel and future cut into approximate 3 x 1 x 2 mm3 slices (L x W x H) and each slice were placed into a separate LoBind tubes (Eppendorf) for destaining ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was eluted with 2 x 100 μl of fresh elution buffer (100 mM dithiothreitol in RNase-free H20) directly into 2 ml lobind tubes (Eppendorf) containing 700μl Buffer RLT (RNeasy MinElute Cleanup Kit ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Soaked biofilms were gently removed from the agar surface using a sterile Drigalski spatula and a pipette tip and together with the unabsorbed stabilization mix transferred into a 2 mL tube (Eppendorf). An additional 1 mL of stabilization buffer was added to the tubes and the content was homogenized with a sterile pestle ...
-
bioRxiv - Developmental Biology 2021Quote: ... the tissue samples were weighed (between 1.4 - 11.0 mg) and transferred into a 2 mL screw cap Eppendorf plastic tubes (Eppendorf, Stevenage, UK) along with a single 5 mm stainless steel ball bearing ...
-
bioRxiv - Neuroscience 2022Quote: ... The homogenate was filtered through a 50 m.um filter (Sysmex; 04-004-2327) into a 2 mL microcentrifuge tube (Eppendorf; 022431048). An additional 0.5 mL of homogenization buffer was used to wash the Dounce homogenizer and filter ...