Labshake search
Citations for Eppendorf :
201 - 250 of 981 citations for 4 6 Difluoro 1 methyl 1H indazole 5 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and centrifuged at 13 000 rpm/15 minutes/4°C (Eppendorf Centrifuge 5415R ...
-
bioRxiv - Microbiology 2024Quote: ... veronii cultures were centrifuged for 4 min at 12,000 rpm (Eppendorf centrifuge 5810R with an F-34-6-38 rotor ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf) with 5% of the immunoprecipitated DNA used in a 20 ul PCR reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a Realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf). Ct values were internally normalized to GAPDH for each sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Melting curves were obtained on a qPCR machine (Eppendorf RealPlex 4), ramping up from 25 to 95 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R). Pre-cleared supernatants were subjected to ultracentrifugation at 29,000 rpm using a Beckman SW40 Ti rotor (RCFavg ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the cells from plasma ...
-
bioRxiv - Microbiology 2021Quote: ... Three 6-mm leaf discs from three separate leaves were punched directly into an Eppendorf tube (Eppendorf, Germany) containing 500 μl of CSPL buffer (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Biochemistry 2022Quote: ... Wholemeal flour samples were weighed (6 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf). Phosphate buffered saline (600 μL ...
-
bioRxiv - Molecular Biology 2024Quote: A total of 350,000 HEK293-T cells were seeded in each well of 6-well plates (#EP0030720113, Eppendorf). Transfection was performed the day after at 40-50% cell confluence ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were eluted with 60 μL of buffer B (80% ACN, 0.1% formic acid in H20) and reduced in a Vacufuge plus (Eppendorf) to a final volume of 3 μL ...
-
bioRxiv - Microbiology 2024Quote: ... coli cultures and mixed with resuspended in a 1X lysis buffer / Hot Acid Phenol solution in a 1.5 mL microcentrifuge tube on a thermomixer (Eppendorf) set to 65°C ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1% trifluoroacetic acid (TFA) (v/v) and the extracts were reduced to dryness using a centrifugal vacuum concentrator (Eppendorf) and re-suspended in 3 % (v/v ...
-
bioRxiv - Cell Biology 2023Quote: Peptides were eluted from home-made StageTips using 60% acetonitrile and 0.1% formic acid and evaporated to complete dryness using a SpeedVac (Eppendorf). Peptides were reconstituted in 2% formic acid and 2% acetonitrile ...
-
bioRxiv - Genomics 2023Quote: ... eluted with 2 x 100 μl of 70 % (v/v) acetonitrile in 0.5 % (v/v) trifluoroacetic acid into low-binding microcentrifugation tubes (Protein LoBind, Eppendorf), and vacuum-dried in Vacufuge Concentrator Plus (Eppendorf) ...
-
bioRxiv - Zoology 2024Quote: ... dried tissue samples were covered with 0.1 µL 2,5- Dihydroxybenzoic acid solution applied with a 0.1–2.5 µL pipette (Eppendorf AB, Hamburg, Germany). For extract analysis ...
-
bioRxiv - Biophysics 2022Quote: ... The lysate was incubated for 30 min on a rotating wheel at 4°C and centrifuged at 16 000 g for 20 min at 4°C (Eppendorf centrifuge 5417-R, Rotor F45-30-11). The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and the pellet was discarded ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Synthetic Biology 2020Quote: ... These reactions were incubated for 0-6 h at 30°C with 500 rpm shaking (Eppendorf, Thermo Mixer C). S ...
-
bioRxiv - Microbiology 2020Quote: ... 0.6 mL culture were centrifuged at 13,350 rpm for 6 min in a Benchtop centrifuge (5424 Eppendorf, Hamburg, Germany). The supernatant was filtered through a 0.22-µm polyvinylidene fluoride syringe filter (Carl Roth ...
-
bioRxiv - Bioengineering 2023Quote: ... these samples were centrifuged for 6 min at 16,740 x g at room temperature (5427 R, Eppendorf, Hamburg, Germany), and the supernatant was discarded ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... pelleted for 10min (4°C, max speed, Eppendorf 5415 D benchtop centrifuge), dried for ~10min under vacuum ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were harvested by centrifugation (3200 g, 40 min, 4 °C; Eppendorf centrifuge 5810 R ...
-
bioRxiv - Bioengineering 2022Quote: ... By centrifugation (3200 g, 30 min, 4 °C; Eppendorf centrifuge 5810 R), soluble proteins were separated from cell fragments and insoluble proteins ...
-
bioRxiv - Bioengineering 2021Quote: ... This was followed by a 4 h centrifugation step (Eppendorf Centrifuge 5424R) at 21,130 × g and 4°C to remove SWCNT aggregates ...
-
bioRxiv - Immunology 2022Quote: ... centrifuging 400xg for 10 min (Eppendorf Centrifuge 5810R, rotor A-4-62) at room temperature to pellet the cells ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at maximum speed for 15 min at 4°C (5804 Eppendorf) to separate phases ...
-
bioRxiv - Genomics 2020Quote: ... and finally held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). PCR products were then purified with the Zymo DNA Clean & Concentrator Kit™ (Zymo Research ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue culture plates were centrifuged at 4° C and 500 rcf (Eppendorf 5810 R tabletop centrifuge ...
-
bioRxiv - Cell Biology 2023Quote: ... tissue culture plates were centrifuged at 4° C and 500 rcf (Eppendorf 5810 R tabletop centrifuge ...
-
bioRxiv - Genomics 2023Quote: ... and pelleted (1000 rcf, 10 min at 4°C) (Eppendorf, 5920 R). Pellet was resuspended in 1mL NIM-DP buffer (0.25M sucrose ...
-
bioRxiv - Microbiology 2024Quote: ... and centrifuged at 12,000 rpm and 4 °C for 10 minutes (Eppendorf).
-
bioRxiv - Neuroscience 2020Quote: We transferred 5 dpf larvae to 1.5 ml centrifuge tubes (Eppendorf). All fish water was aspirated and replaced with 1.0 ml 4% paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... volume was reduced to 5 μL in a Speedvac concentrator (Eppendorf) and sequencing libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina) ...
-
bioRxiv - Bioengineering 2021Quote: ... dissected brains were placed in 5 ml tubes (Eppendorf, 0030 119.401) and covered with 4.5 mL of clearing solution ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were centrifuged at 272g for 5 minutes (Eppendorf 5810R) at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 5 min at 37 °C under agitation (Eppendorf, ThermoMixer C). Lobes were pipetted to promote dissociation ...