Labshake search
Citations for Eppendorf :
151 - 200 of 659 citations for Allopregnanolone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 µl of samples were loaded onto 96-well plates (Eppendorf, Hamburg) and sealed with aluminum foil ...
-
bioRxiv - Immunology 2020Quote: ... single cells were index-sorted into 96-well lo-bind plates (Eppendorf) containing 10µL lysis buffer (TCL 858 (Qiagen ...
-
bioRxiv - Developmental Biology 2019Quote: ... single cells were index-sorted into 96-well lo-bind plates (Eppendorf) containing 10μL lysis buffer (TCL (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... worms in the 96-well plate were stimulated on a thermoshaker (Eppendorf) at 900rpm for 60s ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were plated onto Matrigel-coated glass-bottomed 96-well plates (Eppendorf) at day 4 of differentiation ...
-
bioRxiv - Neuroscience 2022Quote: ... and 10 μL supernatant was aliquoted to a 384-well plate (Eppendorf) using the 384-well module-coupled VPrep liquid handler ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue culture plates were centrifuged at 4° C and 500 rcf (Eppendorf 5810 R tabletop centrifuge ...
-
bioRxiv - Molecular Biology 2022Quote: ... the explants were placed in a black 24-well plate (Eppendorf, Germany), on top of 1 mL sterile ...
-
bioRxiv - Microbiology 2023Quote: ... assay in an Eppendorf AF2200 plate reader (Eppendorf UK Ltd, United Kingdom). For Illumina sequencing ...
-
Mapping resistance-associated anthelmintic interactions in the model nematode Caenorhabditis elegansbioRxiv - Microbiology 2023Quote: ... Assay-ready plates (ARPs) were prepared using an automatic multichannel pipette (Eppendorf) to add 1 μL of 100X drug stock to each well in 96 well plates ...
-
bioRxiv - Systems Biology 2022Quote: ... Single cell or 10 cells were sorted to 96-well plates (Eppendorf) containing 0.5 µL 1% DDM in water by FACS (FACSAria ...
-
bioRxiv - Microbiology 2023Quote: ... cell samples were diluted in 1-ml 96-well plates (Eppendorf, Germany) and stained with 3 μl of the SG/PI staining solution ...
-
bioRxiv - Cell Biology 2023Quote: ... tissue culture plates were centrifuged at 4° C and 500 rcf (Eppendorf 5810 R tabletop centrifuge ...
-
bioRxiv - Genomics 2023Quote: ... The lysate plate was sealed and incubated on a ThermoMixer C (Eppendorf) at 21 °C for 20 minutes shaking at 1000 rpm ...
-
bioRxiv - Microbiology 2023Quote: ... 25µl Matrigel®-organoid suspension was plated in 48 well plates (Eppendorf) and incubated in IntestiCult™ Organoid Growth Medium (STEMCELL Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... Resuspended lipid extracts were diluted 1:10 in 96-well plates (Eppendorf twin tec 96 ...
-
bioRxiv - Immunology 2023Quote: ... The diluted peptides were transferred to a 384-well plate (951020702, Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... and eluted into a protein Lobind plate 96/2000 uL (Eppendorf, EP0030504305) with 3 x 300 μL 50% acetonitrile/0.1% trifluoroacetic acid.
-
bioRxiv - Systems Biology 2024Quote: ... Each deep-well plate was centrifuged at 3220 rcf (Eppendorf Centrifuge 5810R) to pellet the cells ...
-
bioRxiv - Microbiology 2024Quote: ... and 20 µL was transferred to a 384-well PCR plate (Eppendorf) before heating for 10 minutes at 98C ...
-
bioRxiv - Microbiology 2024Quote: ... assay in an Eppendorf AF2200 plate reader (Eppendorf UK Ltd, United Kingdom) and diluted as appropriate.
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Bioengineering 2019Quote: ... for 5 minutes at 3,500 RPM (2,465 x g, Eppendorf 5810R v3.3 centrifuge with A-4-62 rotor ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... All phase-separated droplets were imaged on a 96 glass well plate (Eppendorf). Two-or three-fold concentrated protein or RNA samples were prepared to account for the dilution in mixing with other components to achieve desired final concentrations ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 8 animals were kept at each concentration in a 48-well plate (Eppendorf) and imaged in brightfield at 4x with an Invitrogen EVOS Fl Auto 2 (Thermo-Fisher Scientific ...
-
bioRxiv - Systems Biology 2021Quote: Cells were seeded into wells of a 24-well glass-bottom plate (Eppendorf) ~12 hours prior to imaging ...
-
bioRxiv - Bioengineering 2021Quote: ... All Library preparations were performed on twin.tec PCR Plates LoBind 250 μL (Eppendorf). Library quantitation was performed with Qubit dsDNA HS kit (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... and centrifuged prior to loading into a 96 well plate (Eppendorf, Hamburg, Germany). The well plate was sealed with aluminum sealing foil and kept at 15 °C during the measurement process ...
-
bioRxiv - Cell Biology 2020Quote: ... The reactions were transferred to a 96-well plate (Eppendorf Corp., Hamburg, Germany) for PCR using a thermal cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... made in triplicate and placed in real-time (RT) PCR plates (Eppendorf, 951022015) with clear film (Eppendorf ...
-
bioRxiv - Cell Biology 2022Quote: ... The plates were then heat-sealed using a peelable aluminum seal (Eppendorf, 0030127790) with a thermal microplate sealer (PlateLoc ...
-
bioRxiv - Cancer Biology 2020Quote: Ten thousand FTSEC and HGSOC cells were seeded on imaging plates (Eppendorf: 0030741030) and allowed to grow for 24 hours ...
-
bioRxiv - Biophysics 2021Quote: ... diluted 1:10 in 96-well plates (Eppendorf twin.tec® 96; Sigma-Aldrich). Cholesterol measurements were performed in positive ion mode ...
-
bioRxiv - Microbiology 2021Quote: ... the plate was subjected to centrifugation at 1,000 x g (Eppendorf 5810 R) for 5 min at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... Plates were placed in a programmable incubator “Innova 42” (New Brunswick Scientific/ Eppendorf) at 20°C ...
-
bioRxiv - Systems Biology 2023Quote: ... The peptides from the receiver plate were transferred to protein LoBind tubes (Eppendorf) and the corresponding well was washed with 50 µL of 50% acetonitrile (ACN ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Biochemistry 2023Quote: ... Reaction mixtures were prepared in twin.tec Real-Time PCR Plates (Eppendorf, Hamburg, Germany) and contained 5× SYPRO Orange (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were grown overnight on coverslips in 96-well Cell Imaging Plates (Eppendorf). After washing ...
-
bioRxiv - Biochemistry 2024Quote: ... 40 µL of serum was transferred to a 96-well extraction plate (Eppendorf twin.tec® 96-well LoBind® plate ...
-
bioRxiv - Biochemistry 2024Quote: ... 20 µL of serum were added to a 96- well extraction plate (Eppendorf twin.tec® 96-well LoBind® plate ...