Labshake search
Citations for Eppendorf :
101 - 150 of 420 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... and mitochondrial transcription factor A (TFAM) were quantified by quantitative real-time PCR (Mastercycler® RealPlex2, Eppendorf, Germany), using SYBR Green chemistry (iTaqTM Universal SYBR® Green Supermix ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples were centrifuged at 16.000 x g for 10 min and 100 μL supernatant were transferred to a 1.5 mL low binding micro reaction tube (Eppendorf). For SH-group alkalization ...
-
bioRxiv - Genomics 2022Quote: Sorted and unsorted single cell suspensions (1.2-1.5×103 cells) were transferred into low-binding 1.5 ml Eppendorf tubes (Eppendorf, Hamburg, Germany), centrifuged and washed twice with 1 ml loading buffer (PBS with 0.05% RNase-free BSA ...
-
bioRxiv - Genomics 2023Quote: ... the sample in each 96-well plate was pooled into 12 DNA low-binding 1.5 ml tubes (Eppendorf, 022431021). Genomic DNA (gDNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... all isolated fresh blastomeres or cells were washed three times with CUT&RUN wash buffer to avoid possible contamination and then transferred into a 1.5mL low-binding PCR tube (Eppendorf) containing 100µL of the wash buffer ...
-
bioRxiv - Microbiology 2024Quote: Sample were retrotranscribed in cDNA using 1 µL of RNA with 1 µL of Reverse Transcription Master Mix and 3 µL of RNase-free ultrapure water provided with the kit (Standard Biotools, USA) using a thermal cycler (Eppendorf, Germany) with the following cycles ...
-
bioRxiv - Molecular Biology 2024Quote: ... Precleared protein extracts were transferred to Protein Lobind tubes (Eppendorf) and incubated with pre-washed 50 μl of magnetic-streptavidin beads (MyOne C1 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 μM purified TDP-43-MBP-His6 variants (WT, 5D, 12D, 12A) were set up in low binding tubes (Eppendorf) in 35 μl aggregation buffer (50 mM Tris pH 8.0 ...
-
bioRxiv - Biochemistry 2023Quote: ... then added to 200 μL of Pierce magnetic streptavidin resin (cat. # 8817) in a 2 mL low-binding tube (Eppendorf). Proteins were captured by continuous rotation at room temperature for 1.5 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... Conditioned media and cells were then collected as follows: concentrated PI cocktail dissolved in 30 µL PBS was first filled in the collection tube (low-binding; Eppendorf) and conditioned media was carefully aspirated from the cell layer ...
-
bioRxiv - Biochemistry 2024Quote: ... 3.5 μL 0.1% TFA was added and the proteoCHIP LF 48 was cooled on wet ice to freeze the hexadecane again and allowed for manual separation from the sample containing aqueous phase by transferring the sample to individual wells of a low binding 96 well PCR plate (EP0030129512, twin.tec. PCR Plate 96 LoBind, skirted, Eppendorf, Darmstadt). The EVO96 proteoCHIP did not contain hexadecane and was directly placed on top of a 96well PCR plate to transfer the sample by centrifugation (500 g ...
-
bioRxiv - Biophysics 2020Quote: ... Tween treated Protein LoBind tubes (Protein LoBind Tubes (1.5 ml, Eppendorf)) were incubated for 4 hours with 2% aqueous Tween solution (Tween20 ...
-
bioRxiv - Systems Biology 2022Quote: ... The polar and the non-polar phase were transferred into two new and separate reaction vials (Eppendorf low binding tube, 1.5 mL, Eppendorf, Hamburg, Germany), evaporated to dryness using an Eppendorf Concentrator Plus (Eppendorf ...
-
bioRxiv - Plant Biology 2023Quote: ... The beads were then washed with 3 x 100µL of the lactic acid binding solution and finally resuspended in 50µL and placed into 200 µL tips (Eppendorf, Hauppauge, NY) plugged with 2 layers of 3M™ C8 Empore™ membrane (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... transferred all the tissue fragments from the Petri dish into a clean 5 mL low-binding tube (Eppendorf, cat. no. 0030108.310), and rotated the tube at 20 rpm at room temperature for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Protein LoBind tubes (Eppendorf) and epT.I.P.S ...
-
bioRxiv - Cell Biology 2020Quote: ... protein Lobind tubes (Eppendorf). Elution was repeated and the eluates were pooled ...
-
bioRxiv - Microbiology 2022Quote: ... Protein LoBind tubes (Eppendorf) minimized potential adsorption of protein ...
-
bioRxiv - Immunology 2019Quote: ... 1*106 T cells/condition were harvested 72h after α-CD3/α-CD28 activation and transferred to DNA Lo-binding Eppendorf tubes (Eppendorf). Cells were washed once with PBS and supernatant was completely removed ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Cell Biology 2022Quote: ... Sorted nuclei were then centrifuged at 1000 g for 15 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3), and supernatant was removed ...
-
bioRxiv - Physiology 2021Quote: ... in protein LoBind tubes (Eppendorf). Probes were then homogenized at 4°C in Bioruptor Pico sonicator (Diagenode) ...
-
bioRxiv - Biophysics 2024Quote: ... in Protein LoBind Tubes (Eppendorf). Protein levels were normalized via Bradford assay (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... The suspension was centrifuged at 1500 rpm for 5 minutes at 4°C and the pellet was resuspended in cold growth factor reduced Matrigel and aliquoted (15 μL per well) in a 48 well plate (Eppendorf, Cat#0030723113). Matrigel was let to polymerize for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... transferred to protein LoBind tubes (Eppendorf), and minced ...
-
bioRxiv - Molecular Biology 2020Quote: ... into protein LoBind tubes (Eppendorf, Germany). Just before encapsulation ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein LoBind® tubes from Eppendorf; Trypsin (V5111 ...
-
bioRxiv - Biophysics 2022Quote: ... aliquoted into Protein LoBind tubes (Eppendorf), and stored at 4°C (maximum 48 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... antibodies in Protein LoBind tubes (Eppendorf). Thereafter ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein was quantified on a BioSpectrometer (Eppendorf) with a Bradford Assay (Bradford Reagent-E530-1L) ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein LoBind microfuge tubes (1.5 ml, Eppendorf) were used to further minimize non-specific binding to the walls of the reaction vessel ...
-
bioRxiv - Microbiology 2020Quote: ... The protein content was colorimetrically determined (Eppendorf Biophotometer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and stored in Protein LoBind tubes (Eppendorf) at −80°C.
-
bioRxiv - Neuroscience 2019Quote: ... Protein concentration of the supernatant was determined by measuring protein absorbance at 280 nm using a photometer (BioPhotometer, Eppendorf) and employing the Beer-Lambert law ...
-
bioRxiv - Biochemistry 2020Quote: ... Measurements at different protein concentrations were carried out by adding to the reaction small volumes of protein diluted in RB in ‘Protein LoBind’ 1.5 mL tubes (Eppendorf). No oxygen-scavenging or triplet-quenching additives were used.
-
bioRxiv - Biochemistry 2021Quote: ... Dynabeads were separated magnetically and elution buffer containing biotinylated proteins was transferred to a new 1.5 ml LoBind protein tube (Eppendorf). 70 µl of sample was electrophoresed on a NuPAGETM 4-12% Bis-Tris protein gel (Invitrogen) ...
-
bioRxiv - Plant Biology 2019Quote: ... A volume of each protein extract corresponding to 16 mg protein was transferred into a new 5 ml LoBind tube (Eppendorf) containing Dynabeads MyOne Streptavidin C1 (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein concentration was determined according to the Bradford method (BioRad protein Assay, Spectrophotemeter Eppendorf biophotometer plus at 595 nm). Full-length APP and APP-CTFs were resolved on 16.5% Tris-Tricine SDS-PAGE then transferred onto nitrocellulose membranes which were boiled in PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... proteins were dried in a vacuum concentrator (Eppendorf) and resolubilized in 50 µL of 100 mM TEAB ...
-
bioRxiv - Microbiology 2020Quote: ... Hemolymph was collected into protein LoBind tubes (Eppendorf) from 60 cold anesthetized mosquitoes 20 min post-injection into 48 μL collection buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was loaded in Femtotips II (Eppendorf) and injection was done with an injection pressure of 1.0 hPa ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein concentrations were measured by using BioSpectrometer (Eppendorf).
-
bioRxiv - Cancer Biology 2023Quote: ... then transferred to a protein LoBind tube (Eppendorf) for overnight digestion ...
-
bioRxiv - Biochemistry 2023Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed in protein LoBind tubes (Eppendorf) and then immediately transferred into a 96-well non-binding plate (Greiner Bio-one) ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...