Labshake search
Citations for Eppendorf :
101 - 150 of 453 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were loaded with 5µL of tubulin solution and connected to a FemtoJet 4i (Eppendorf). Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf) ...
-
bioRxiv - Genetics 2024Quote: ... The solution was backfilled into an injection needle with positive balancing pressure (Transjector 5246, Eppendorf) and injected into the cytoplasm of zygotes of C57BL/6 background ...
-
bioRxiv - Neuroscience 2024Quote: ... the peptide solution was brought to room temperature and subjected to centrifugation (Eppendorf, Centrifuge 5430R) at 20,800 g for 10 min at 4°C to clear and separate particulate material ...
-
bioRxiv - Biophysics 2024Quote: ... the solutions were spun down at 15000 rpm for 2 hours (Microcentrifuge 5430, Eppendorf, MA) and the pellets containing the insoluble species were collected ...
-
bioRxiv - Genomics 2024Quote: ... The aqueous phase solution was transferred to a new 1.5 mL centrifuge tube (Eppendorf, 05414203). 500 μl of 100% isopropanol (MilliporeSigma ...
-
bioRxiv - Microbiology 2024Quote: ... the 1 ml cell solution was collected and transferred into a 1.5-ml tube (Eppendorf) and centrifuged at 5,000 × g for 5 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The capillaries were backfilled with the injection solution using the GELoader tip (Eppendorf, Tokyo, Japan) and connected to the IM-400 microinjector (Narishige ...
-
bioRxiv - Systems Biology 2021Quote: ... The six 96-well master plates were then re-arrayed into the final 384 well v-bottom PCR Plates (Eppendorf #951020702).
-
bioRxiv - Biochemistry 2022Quote: ... 50 µl of 50 mM ammonium bicarbonate was added to the gel pieces and incubated with 16.6 µl of propionylation reagent (1:3 v/v propionic anhydride in acetonitrile) for 15 mins at 37°C with agitation in a thermomixer at 900 rpm (Eppendorf, UK). The supernatant was then removed and the derivatisation process was repeated ...
-
bioRxiv - Neuroscience 2020Quote: We transferred 5 dpf larvae to 1.5 ml centrifuge tubes (Eppendorf). All fish water was aspirated and replaced with 1.0 ml 4% paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... volume was reduced to 5 μL in a Speedvac concentrator (Eppendorf) and sequencing libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina) ...
-
bioRxiv - Bioengineering 2021Quote: ... dissected brains were placed in 5 ml tubes (Eppendorf, 0030 119.401) and covered with 4.5 mL of clearing solution ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were centrifuged at 272g for 5 minutes (Eppendorf 5810R) at 4°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 5 min at 37 °C under agitation (Eppendorf, ThermoMixer C). Lobes were pipetted to promote dissociation ...
-
bioRxiv - Bioengineering 2023Quote: ... and centrifuged at 8000 rpm for 5 min (Centrifuge 5430, Eppendorf), where the dissociated monomers or oligomers were separated and mainly located in the supernatant ...
-
bioRxiv - Plant Biology 2024Quote: ... The seedlings were first placed in 5 mL tubes (Eppendorf #0030119460) and snap frozen in liquid nitrogen.
-
bioRxiv - Cell Biology 2024Quote: Cell culture maintenance incubator (37 °C, 5% CO2, humidified; Eppendorf CellXpert)
-
bioRxiv - Biophysics 2021Quote: ... The bead solution was vortexed at 1500 rpm at 37 °C using Thermal Mixer C (Eppendorf) for 1 hour to complete the membrane coating process ...
-
bioRxiv - Molecular Biology 2022Quote: ... The solution was then clarified by centrifugation in a low-speed centrifuge 5804R (Eppendorf, Hamburg, Germany) at 10,000 rpm (12,857 × g ...
-
bioRxiv - Biophysics 2024Quote: ... The phase separated solution was then incubated at respective temperatures in a thermocycler (Mastercycler nexus, Eppendorf) for 20 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 10 µL was transferred to a PCR-clean polypropylene V bottom 96-well plate and covered with a silicone seal (Eppendorf, Mississauga, ON). Reactions were incubated at 29°C for 16 hours and final reactions stored at -20°C ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting supernatant was removed and the DNA pellet was dried in a vacuum concentrator (Eppendorf concentrator plus, 10 min, V-AL). DNA was eluted in DEPC water and stored at -20 °C until metagenomic library preparation.
-
bioRxiv - Cell Biology 2020Quote: ... This solution was centrifuged at 3000g for 2 min and the supernatant was collected and concentrated in a vacuum concentrator in vacuum-alcoholic (V-AL) mode (Eppendorf plus, Eppendorf, Hamburg, Germany). The concentrated crystals were resuspended in 100μl of 1 X PBS and Nuclease Free Water (NFW) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The sample containing tryptic peptides was reduced to 10% of the original volume using a Concentrator Plus (Eppendorf, #5305000304, settings V-AQ) to remove acetonitrile and purified using the StageTip protocol.
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: HEK-293T cells were cultured at 37 °C and 5% CO2 (Eppendorf). Cells were plated in 60 mm dishes and transfected with 1 ug of GFP-TAX4 and 3 ug of PEI-MAX per dish ...
-
bioRxiv - Neuroscience 2020Quote: ... Male heads were incubated for 5 min on a ThermoMixer (Eppendorf 5382000023), and 25 min in a rotating hybridization oven ...
-
bioRxiv - Molecular Biology 2022Quote: ... The beads were then transferred to a 5 mL centrifuge tube (Eppendorf) and filled up completely with TEV buffer ...
-
Proteome Profiling of Cerebrospinal Fluid Reveals Novel Biomarker Candidates for Parkinson’s DiseasebioRxiv - Systems Biology 2021Quote: ... samples were shaken for 5 min at 2,000 rpm (thermomixer C, Eppendorf). Peptide concentrations were measured optically at 280nm (Nanodrop 2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... All cell centrifugations were done at 1800 rpm for 5 minutes (Eppendorf). Cells were resuspended in 200 µL of cold PBS and then 1 mL of 4% PFA was added then incubated ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated for 5 min at 70 °C in ThermoMixer® (Eppendorf).
-
bioRxiv - Molecular Biology 2023Quote: ... The beads were then transferred to a 5 mL centrifuge tube (Eppendorf) and filled up completely with TEV buffer B ...
-
bioRxiv - Molecular Biology 2023Quote: ... The beads were then transferred to a 5 mL centrifuge tube (Eppendorf) and filled up completely with lysis buffer B ...
-
bioRxiv - Molecular Biology 2023Quote: ... The beads were then transferred to a 5 mL centrifuge tube (Eppendorf) and filled up completely with TEV buffer ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were then placed in 5 mL snap-cap tubes (Eppendorf 0030119401) in 3 mL wash medium supplemented with 0.2 U/mL collagenase A ...
-
bioRxiv - Immunology 2023Quote: ... Pellets were placed in 5 ml microcentrifuge tubes (Eppendorf™, Hamburg, Germany) and their weight determined to calculate the eggs per gram of feces (EPG) ...
-
bioRxiv - Systems Biology 2023Quote: The mixtures were transferred to 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at max ...