Labshake search
Citations for Eppendorf :
101 - 150 of 873 citations for 6 Methylimidazo 2 1 b thiazole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... a 6 mL portion of each cell culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Bioengineering 2019Quote: ... The suspension was centrifuged at 500 rcf for 10 min RT (Eppendorf 5430; Rotor: F-35-6-30). These steps were repeated until a white cell pellet was obtained (indicating erythrocyte depletion) ...
-
bioRxiv - Microbiology 2021Quote: ... Three 6-mm leaf discs from three separate leaves were punched directly into an Eppendorf tube (Eppendorf, Germany) containing 500 μl of CSPL buffer (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Biochemistry 2022Quote: ... Wholemeal flour samples were weighed (6 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf). Phosphate buffered saline (600 μL ...
-
bioRxiv - Molecular Biology 2024Quote: A total of 350,000 HEK293-T cells were seeded in each well of 6-well plates (#EP0030720113, Eppendorf). Transfection was performed the day after at 40-50% cell confluence ...
-
bioRxiv - Cancer Biology 2021Quote: ... 30-70 kDa lane portions were excised into 2×2 mm cubes and transferred to Protein Lo-Bind tubes (Eppendorf). Excised gels were partitioned into tubes ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissues were fixed in 2% paraformaldehyde for 55 minutes at room temperature in 2 mL Protein LoBind tubes (Eppendorf 022431064). Fixative was removed and tissues were washed 4x 10 minutes with 1.5 mL PBS with 0.5% Triton X-100 (PBT) ...
-
bioRxiv - Biochemistry 2019Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Immunology 2021Quote: ... and collected into sterile 2 ml tubes (Eppendorf). All samples were immediately snap frozen in dry ice and stored at –80 °C until DNA extraction.
-
bioRxiv - Plant Biology 2023Quote: ... in individual 2 mL safe-lock tubes (Eppendorf). The suspensions were briefly vortexed to homogeneity and incubated at room temperature for 2 hours ...
-
bioRxiv - Biochemistry 2023Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... transferred into 2 mL reaction tubes (Eppendorf, Germany), and frozen at −20 ℃ until further use ...
-
bioRxiv - Cell Biology 2023Quote: ... connected to a 2 ml microcentrifuge tube (Eppendorf) with an air-tight metal tube cap (P-CAP 2 mL High Pressure ...
-
bioRxiv - Molecular Biology 2021Quote: ... Flowrate was adjusted at 2 ml/min to collect peptides in 1 ml fractions in low-protein binding Eppendorf tubes (Eppendorf LoBind tubes, cat. no. EPPE0030108.116). The bound complexes were separated from β2 microglobulin and heavy chain using increasing concentration of buffer B ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Bioengineering 2019Quote: ... for 5 minutes at 3,500 RPM (2,465 x g, Eppendorf 5810R v3.3 centrifuge with A-4-62 rotor ...
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Biochemistry 2022Quote: ... and incubated with Methoxamine hydrochloride (MeOX-HCl, 2%, 40 μl) at 60 °C for 2 hours at 400 rpm in a thermomixer (Eppendorf, USA). After adding N-methyl-N-(trimethylsilyl ...
-
bioRxiv - Synthetic Biology 2020Quote: ... These reactions were incubated for 0-6 h at 30°C with 500 rpm shaking (Eppendorf, Thermo Mixer C). S ...
-
bioRxiv - Developmental Biology 2019Quote: ... 6 day-old tapeworms were obtained and microinjected with dsRNA using femtotips II via the Femtojet injection system (Eppendorf) to obtain spreading across the first ∼ 3-4 mm anterior of the tapeworm ...
-
bioRxiv - Microbiology 2019Quote: ... Columns were placed into microcentrifuge tubes and incubated for 6 hr at 37 °C in a Thermomixer S (Eppendorf) without shaking ...
-
bioRxiv - Microbiology 2020Quote: ... 0.6 mL culture were centrifuged at 13,350 rpm for 6 min in a Benchtop centrifuge (5424 Eppendorf, Hamburg, Germany). The supernatant was filtered through a 0.22-µm polyvinylidene fluoride syringe filter (Carl Roth ...
-
bioRxiv - Neuroscience 2020Quote: The homogenates were pelleted at 400xg for 6 minutes at 4°C in a swing-bucket rotor centrifuge (Eppendorf). The supernatants were removed and 1 ml ice-cold DPBS (pH 7.3-7.4 ...
-
bioRxiv - Genetics 2019Quote: ... and incubated for 6 days at 20°C while shaking at 200 rpm (New Brunswick I26/I26R shaker, Eppendorf). A stereomicroscope was used to assess developmental stage after 6 days incubation ...
-
bioRxiv - Bioengineering 2023Quote: ... these samples were centrifuged for 6 min at 16,740 x g at room temperature (5427 R, Eppendorf, Hamburg, Germany), and the supernatant was discarded ...
-
bioRxiv - Neuroscience 2021Quote: ... Each cage contained two 2 mL feeding vials (Eppendorf) pierced with two 2 mm holes at the bottom to allow drinking of the sucrose solutions they contained ...
-
bioRxiv - Systems Biology 2020Quote: ... This biomass suspension in a vial (2 ml, Eppendorf) was thoroughly mixed with pipette and all vials were incubated at 30°C for 45 min under moderate agitation conditions ...
-
bioRxiv - Microbiology 2021Quote: ... was collected in a 2 mL microcentrifuge tube (Eppendorf). Following encapsulation ...
-
bioRxiv - Genetics 2022Quote: ... 1.5 ml or 2 ml DNA LoBind tubes (Eppendorf) were used to wash cells in PBS and downstream processing steps ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to a 2 mL heavy lock tube (Eppendorf) and centrifuged at 16 000 x g for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... supernatants were transferred to 2 ml reaction tubes (Eppendorf) and diluted 1:1 with 1 ml of 50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2023Quote: ... in a 2 mL safe-lock microcentrifuge tube (Eppendorf), using liquid nitrogen ...
-
bioRxiv - Genetics 2023Quote: ... 1.5 ml or 2 ml DNA LoBind tubes (Eppendorf) were used to wash cells in PBS and downstream processing steps ...
-
bioRxiv - Microbiology 2023Quote: ... we placed them in 2-mL microtubes (Eppendorf, Germany) containing 250-µL GTC solution (100 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2020Quote: We transferred 5 dpf larvae to 1.5 ml centrifuge tubes (Eppendorf). All fish water was aspirated and replaced with 1.0 ml 4% paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... volume was reduced to 5 μL in a Speedvac concentrator (Eppendorf) and sequencing libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina) ...
-
bioRxiv - Bioengineering 2021Quote: ... dissected brains were placed in 5 ml tubes (Eppendorf, 0030 119.401) and covered with 4.5 mL of clearing solution ...
-
bioRxiv - Biophysics 2023Quote: ... and applied 1,700 V for about 5 ms (Eppendorf Eporator, 4309000027). We quickly washed the cuvette with 500 μl SOC growth medium twice and cells were allowed to recover at 37 °C for 1 hour in a 50 ml conical tube (Corning ...