Labshake search
Citations for Eppendorf :
101 - 150 of 649 citations for 4' O beta Glucopyranosyl 5 O methylvisamminol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). The compensation pressure set on the FemtoJet was 35hPa for the whole injection experiment to avoid damages on cells ...
-
bioRxiv - Biophysics 2022Quote: ... The probe was controlled with a micromanipulator (Injectman 4; Eppendorf) and mounted on an inverted epifluorescent microscope.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Physiology 2023Quote: ... for 1 h at 4 □ on a ThermoMixer C (Eppendorf), 350 µl of water and 250 µl of chloroform were added to the mixture to induce phase separation ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the remaining blood cells from the plasma.
-
bioRxiv - Cell Biology 2024Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). Microinjection of cells were performed on an inverted microscope (Nikon Ti2 Eclipse ...
-
bioRxiv - Bioengineering 2024Quote: ... Homogenates were agitated at 4°C in a thermomixer (Eppendorf) for 2 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... The probe was controlled with a micromanipulator (Injectman 4, Eppendorf), and mounted on an inverted epifluorescence microscope.
-
bioRxiv - Cell Biology 2024Quote: ... 4℃ for 15 min using Eppendorf 5810R Centrifuge (Eppendorf, Germany) with A-4-81 Rotor (Eppendorf ...
-
bioRxiv - Genetics 2024Quote: ... in a 96-well Eppendorf Realplex 4 PCR machine (Eppendorf).
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged (Eppendorf 5810R, 3,220 x g, 4 °C, 1 min), and the absorbance was measured at 494 nm (CLARIOstar ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4°C for 10 minutes using a 5415R microcentrifuge (Eppendorf) and supernatants were transferred ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were centrifuged (20 min, 15,000g, 4°C, in an Eppendorf 5810R centrifuge ...
-
bioRxiv - Genomics 2021Quote: ... and held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). This was then cycled a total of 40 times ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and centrifuged at 13 000 rpm/15 minutes/4°C (Eppendorf Centrifuge 5415R ...
-
bioRxiv - Microbiology 2024Quote: ... veronii cultures were centrifuged for 4 min at 12,000 rpm (Eppendorf centrifuge 5810R with an F-34-6-38 rotor ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf) with 5% of the immunoprecipitated DNA used in a 20 ul PCR reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a Realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf). Ct values were internally normalized to GAPDH for each sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... Melting curves were obtained on a qPCR machine (Eppendorf RealPlex 4), ramping up from 25 to 95 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R). Pre-cleared supernatants were subjected to ultracentrifugation at 29,000 rpm using a Beckman SW40 Ti rotor (RCFavg ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the cells from plasma ...
-
bioRxiv - Biophysics 2022Quote: ... The lysate was incubated for 30 min on a rotating wheel at 4°C and centrifuged at 16 000 g for 20 min at 4°C (Eppendorf centrifuge 5417-R, Rotor F45-30-11). The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and the pellet was discarded ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... pelleted for 10min (4°C, max speed, Eppendorf 5415 D benchtop centrifuge), dried for ~10min under vacuum ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were harvested by centrifugation (3200 g, 40 min, 4 °C; Eppendorf centrifuge 5810 R ...
-
bioRxiv - Bioengineering 2022Quote: ... By centrifugation (3200 g, 30 min, 4 °C; Eppendorf centrifuge 5810 R), soluble proteins were separated from cell fragments and insoluble proteins ...
-
bioRxiv - Bioengineering 2021Quote: ... This was followed by a 4 h centrifugation step (Eppendorf Centrifuge 5424R) at 21,130 × g and 4°C to remove SWCNT aggregates ...
-
bioRxiv - Immunology 2022Quote: ... centrifuging 400xg for 10 min (Eppendorf Centrifuge 5810R, rotor A-4-62) at room temperature to pellet the cells ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at maximum speed for 15 min at 4°C (5804 Eppendorf) to separate phases ...
-
bioRxiv - Genomics 2020Quote: ... and finally held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). PCR products were then purified with the Zymo DNA Clean & Concentrator Kit™ (Zymo Research ...
-
bioRxiv - Cell Biology 2022Quote: ... Tissue culture plates were centrifuged at 4° C and 500 rcf (Eppendorf 5810 R tabletop centrifuge ...