Labshake search
Citations for Eppendorf :
101 - 150 of 813 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... at 10.000 rpm and 4°C (Eppendorf 5804R), for the removal of residual titanium [16].
-
bioRxiv - Cell Biology 2022Quote: ... for 10 minutes at 4°C (Eppendorf, Germany), and supernatants were transferred into fresh tubes to be evaporated to dryness in a CentreVap concentrator at 40°C (Labconco ...
-
bioRxiv - Bioengineering 2024Quote: ... 15 min at 4°C (Eppendorf, Hamburg, Germany). duRNA was generated through equimolar annealing of trRNA/crRNA in duplex buffer (IDT) ...
-
bioRxiv - Microbiology 2024Quote: ... or MasterCycler EP Realplex 4 thermal cycler (Eppendorf). Data were analyzed using recA and gyrA as internal controls ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 4°C for 1 hour and centrifuged at 4°C at 14200 rpm for 50 min using a refrigerated table-top centrifuge (Eppendorf Centrifuge, Hamburg, Germany). The cleared lysates were loaded on wells of 96-well single-use filter micro-plates with 3 µm glass fibers and 25 µm polyethylene membranes (Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were then digested for 4 h at 37°C (1000 x rpm for 1 h, then 650 x rpm, Eppendorf ThermoMixer®C). Samples were then diluted 1:1 with milliQ water ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Biophysics 2020Quote: ... The cell suspension was subsequently centrifuged for 30 min at 4°C and 3250 × g (Eppendorf Swing-bucket rotor A-4-62). The supernatant was discarded ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 10 sec (5424-R Eppendorf microfuge) and the pellet was resuspended with 400 μl TES Solution (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 20°C for 4 hours (Thermomixer 5355 R, Eppendorf). After incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in a Realplex 4 Thermocycler (Eppendorf) using the following program ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C for 20 minutes (Eppendorf® 5418 R) to collect all the cells ...
-
bioRxiv - Genetics 2024Quote: ... 000 RPM for 10 minutes at 4°C (Eppendorf), followed by transfer of the plasma to tubes ...
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Biophysics 2021Quote: ... Lipid extracts were resuspended in 60 μl 10mM ammonium acetate in methanol and diluted 1:4 in 96-well plates (Eppendorf twin.tec® 96; Sigma-Aldrich) prior to measurement of PC species ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and then 6 mL of the culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at room temperature.
-
bioRxiv - Microbiology 2024Quote: An agar plug (6 mm diameter) of the bacterial culture was transferred to a vial (Eppendorf) and extracted with 1 mL of isopropanol ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). The compensation pressure set on the FemtoJet was 35hPa for the whole injection experiment to avoid damages on cells ...
-
bioRxiv - Biophysics 2022Quote: ... The probe was controlled with a micromanipulator (Injectman 4; Eppendorf) and mounted on an inverted epifluorescent microscope.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the remaining blood cells from the plasma.
-
bioRxiv - Bioengineering 2024Quote: ... Homogenates were agitated at 4°C in a thermomixer (Eppendorf) for 2 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). Microinjection of cells were performed on an inverted microscope (Nikon Ti2 Eclipse ...
-
bioRxiv - Cell Biology 2024Quote: ... The probe was controlled with a micromanipulator (Injectman 4, Eppendorf), and mounted on an inverted epifluorescence microscope.
-
bioRxiv - Genetics 2024Quote: ... in a 96-well Eppendorf Realplex 4 PCR machine (Eppendorf).
-
bioRxiv - Cell Biology 2024Quote: ... 4℃ for 15 min using Eppendorf 5810R Centrifuge (Eppendorf, Germany) with A-4-81 Rotor (Eppendorf ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4°C for 10 minutes using a 5415R microcentrifuge (Eppendorf) and supernatants were transferred ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a 6 mL portion of each cell culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: For esiRNA transfection 35,000 U2OS cells were seeded in 2 ml medium in 6-well plates (Eppendorf) the evening before transfection ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were centrifuged (20 min, 15,000g, 4°C, in an Eppendorf 5810R centrifuge ...
-
bioRxiv - Genomics 2021Quote: ... and held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). This was then cycled a total of 40 times ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and centrifuged at 13 000 rpm/15 minutes/4°C (Eppendorf Centrifuge 5415R ...
-
bioRxiv - Molecular Biology 2023Quote: ... Melting curves were obtained on a qPCR machine (Eppendorf RealPlex 4), ramping up from 25 to 95 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R). Pre-cleared supernatants were subjected to ultracentrifugation at 29,000 rpm using a Beckman SW40 Ti rotor (RCFavg ...
-
bioRxiv - Cancer Biology 2024Quote: ... or a realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf) with 5% of the immunoprecipitated DNA used in a 20 ul PCR reaction ...
-
bioRxiv - Cancer Biology 2024Quote: ... in a Realplex 4 qPCR 96-Well Real Time Cycler (Eppendorf). Ct values were internally normalized to GAPDH for each sample ...
-
bioRxiv - Microbiology 2024Quote: ... veronii cultures were centrifuged for 4 min at 12,000 rpm (Eppendorf centrifuge 5810R with an F-34-6-38 rotor ...
-
bioRxiv - Microbiology 2023Quote: ... The resulting supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the cells from plasma ...
-
bioRxiv - Microbiology 2021Quote: ... Three 6-mm leaf discs from three separate leaves were punched directly into an Eppendorf tube (Eppendorf, Germany) containing 500 μl of CSPL buffer (Omega Bio-Tek ...
-
bioRxiv - Molecular Biology 2024Quote: A total of 350,000 HEK293-T cells were seeded in each well of 6-well plates (#EP0030720113, Eppendorf). Transfection was performed the day after at 40-50% cell confluence ...
-
bioRxiv - Biochemistry 2022Quote: ... Wholemeal flour samples were weighed (6 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf). Phosphate buffered saline (600 μL ...
-
bioRxiv - Biophysics 2022Quote: ... The lysate was incubated for 30 min on a rotating wheel at 4°C and centrifuged at 16 000 g for 20 min at 4°C (Eppendorf centrifuge 5417-R, Rotor F45-30-11). The supernatant was transferred to a fresh 1.5 ml Eppendorf tube and the pellet was discarded ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...