Labshake search
Citations for Eppendorf :
51 - 100 of 864 citations for tert Butyl 2 chloro 5H pyrrolo 3 4 b pyridine 6 7H carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: The cjFFs were transfected at P4-6 with Multiporator (Eppendorf) according to the protocol provided by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: ... with an fixed angled-rotor (FA-45-6-30, Eppendorf) and the virus pellet was resuspended in OPC-Sato medium for 1 hour at 4°C on a shaker ...
-
bioRxiv - Physiology 2022Quote: ... plasma was spun at 4°C (4 min, 4000g force, Eppendorf 5804R, Mississauga, ON), decanted and stored at −80°C for subsequent ELISAs ...
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
bioRxiv - Microbiology 2022Quote: ... falciparum parasites were cultured in human red blood cells (O+ or B+, Universitätsklinikum Eppendorf, Hamburg, Germany) at 5 % haematocrit in an atmosphere of 1% O2 ...
-
bioRxiv - Genomics 2024Quote: ... 4 °C with acceleration and deceleration set to 1 (Eppendorf 5910 Ri, Rotor S-4×400).
-
bioRxiv - Neuroscience 2020Quote: ... and rotor (Eppendorf #S-4-72). Upon end of centrifugation ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). Proteins in the clear supernatant (protein extract ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). 15 µg of recombinant FAMOSS-streptavidin/streptavidin was added to supernatant and incubated 1h on ice with rotation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... in a MasterCycler RealPlex 4 (Eppendorf). Each 20 μL qPCR reaction contained 90 ng of cDNA ...
-
bioRxiv - Biophysics 2023Quote: ... with a micromanipulator InjectMan 4 (Eppendorf). The injection needles Femtotip II (Eppendorf ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 °C (Eppendorf, Centrifuge 5810 R). Next ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μL droplets were inoculated into 6-well plates (Eppendorf, Hamburg, Germany). After allowing the cells to adhere to the surface for 2 hours in a CO2 incubator (37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Genomics 2024Quote: ... 80 µL H2O) for 6 minutes on a shaker (Eppendorf Thermomixer Comfort) at 28°C and 400 rpm ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Genomics 2023Quote: ... and centrifuged at 3,200 g and 4°C using a swinging-bucket rotor (Eppendorf A-4-81) for 5 mins ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... falciparum 3D7 (68) were cultured in human red blood cells (O+ or B+, Blood bank, Universitätsklinikum Hamburg-Eppendorf). Cultures were maintained at 37°C in an atmosphere of 1% O2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged Z-B dimers (to 25 nM in 25 µL) in a 1.5-mL LoBind tube (Eppendorf). Then canonical nucleosomes (from native or recombinant source ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... (Eppendorf Centrifuge 5810R, rotor A-4-62) at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... in a Realplex 4 PCR machine (Eppendorf), and values were normalized to rpl-32 as an internal control ...
-
bioRxiv - Biophysics 2022Quote: ... and a micro-manipulator (Injectman 4; Eppendorf). Injection pipettes were prepared from siliconized (Sigmacote ...
-
bioRxiv - Cell Biology 2023Quote: ... in a realplex 4 qPCR cycler (Eppendorf). To calculate the relative mtDNA levels ...
-
bioRxiv - Cell Biology 2024Quote: ... and a micro-manipulator (Injectman 4, Eppendorf). Injection needles were prepared from siliconized (Sigmacote ...
-
bioRxiv - Molecular Biology 2024Quote: Centrifuge rotor A-4-62 (Eppendorf, 022638009)
-
bioRxiv - Cell Biology 2024Quote: ... with A-4-81 Rotor (Eppendorf, Germany) to remove the dead cells and cell debris ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Injection was performed with InjectMan 4 (Eppendorf) and Eppendorf femtotips using an Olympus IX71 microscope ...
-
bioRxiv - Microbiology 2024Quote: ... spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were eluted with 60 μL of buffer B (80% ACN, 0.1% formic acid in H20) and reduced in a Vacufuge plus (Eppendorf) to a final volume of 3 μL ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Genomics 2024Quote: ... 6-8×105 cells were sorted in a 5mL low binding tube (Eppendorf, 0030122356) pre-coated with 1mL of 1X PBS + 0.04%BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 10,000 × g for 40 min using with FA-45-6-30 Rotor (Eppendorf, Germany), 100,000 × g ultracentrifugation for 90 min using Himac CP70NE Ultracentrifuge (Himac ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Biophysics 2024Quote: ... a 2 mL tube (Eppendorf), containing 1 mL of a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL tube (Eppendorf), containing a suspended cells at a 5 million per mL concentration in a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were immediately cooled on ice and centrifuged for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The cell pellets were stored at −20°C until RNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... The cells were transferred into anaerobic 50 mL reaction tubes inside the anaerobic chamber and harvested outside of the anaerobic chamber for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The supernatant was discarded inside the anaerobic chamber and the pellet was resuspended in fresh RCM medium to an OD600 of 5-10 ...
-
bioRxiv - Neuroscience 2024Quote: Suspensions were centrifuged at 4°C in 50 mL centrifuge tubes (Falcon) with a 5810R centrifuge and an A-4-81 rotor (Eppendorf) and in 38.5 mL polyallomer Ultra Clear ultracentrifuge tubes (Beckman Coulter ...
-
bioRxiv - Cell Biology 2022Quote: ... and InjectMan®4 micromanipulator (Cat#. 5192000035, Eppendorf) using external continuous pressure ...
-
bioRxiv - Immunology 2021Quote: ... at 10.000 rpm and 4°C (Eppendorf 5804R), for the removal of residual titanium [16].
-
bioRxiv - Cell Biology 2022Quote: ... for 10 minutes at 4°C (Eppendorf, Germany), and supernatants were transferred into fresh tubes to be evaporated to dryness in a CentreVap concentrator at 40°C (Labconco ...
-
bioRxiv - Bioengineering 2024Quote: ... 15 min at 4°C (Eppendorf, Hamburg, Germany). duRNA was generated through equimolar annealing of trRNA/crRNA in duplex buffer (IDT) ...
-
bioRxiv - Microbiology 2024Quote: ... or MasterCycler EP Realplex 4 thermal cycler (Eppendorf). Data were analyzed using recA and gyrA as internal controls ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...