Labshake search
Citations for Eppendorf :
51 - 100 of 358 citations for Polystyrene Latex Beads 5 um since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... each bead was transferred with sterilised tweezers into a 1.5 ml microcentrifuge tube (Eppendorf, Germany) containing 1 ml saline ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Biophysics 2021Quote: ... The bead solution was vortexed at 1500 rpm at 37 °C using Thermal Mixer C (Eppendorf) for 1 hour to complete the membrane coating process ...
-
bioRxiv - Biochemistry 2022Quote: ... Unbound lysate was aspirated and the beads transferred to a 2 ml LoBind protein tube (Eppendorf) using 2% SDS wash buffer (150 mM NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... Samples were then added to the washed beads and mixed on a plate shaker (Eppendorf, ThermoMix C) for 5min at 200g ...
-
bioRxiv - Neuroscience 2022Quote: ... the flowthrough was removed and the beads were transferred to Protein Lo-bind tubes (Eppendorf CAT# 022431081). Beads were washed twice with 500 µl 2% SDS in H2O ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins captured on beads were digested overnight at 370C under vigorous shaking (1200 rpm, Eppendorf Thermomixer, #5382) supplemented with 0.5 µg Trypsin/LysC (MS grade ...
-
bioRxiv - Microbiology 2020Quote: ... with the exception that glycopeptide enrichment and bead washing was performed using an epMotion 5073m (Eppendorf, Hamburg, Germany). For each sample ...
-
bioRxiv - Microbiology 2023Quote: ... two milliliters of the fermentation broth containing the suspended mucin beads were sampled to 2-ml tubes (Eppendorf). The serum bottles were opened and closed carefully each time to avoid contamination in the anaerobic workstation ...
-
bioRxiv - Plant Biology 2022Quote: ... The captured-on beads proteins were digested overnight at 37°C under vigorous shaking (1200 rpm, Eppendorf Thermomixer) with 1 ug Trypsin/LysC (MS grade ...
-
bioRxiv - Neuroscience 2020Quote: We transferred 5 dpf larvae to 1.5 ml centrifuge tubes (Eppendorf). All fish water was aspirated and replaced with 1.0 ml 4% paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... volume was reduced to 5 μL in a Speedvac concentrator (Eppendorf) and sequencing libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina) ...
-
bioRxiv - Bioengineering 2021Quote: ... dissected brains were placed in 5 ml tubes (Eppendorf, 0030 119.401) and covered with 4.5 mL of clearing solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 5 min at 37 °C under agitation (Eppendorf, ThermoMixer C). Lobes were pipetted to promote dissociation ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were centrifuged at 272g for 5 minutes (Eppendorf 5810R) at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... and centrifuged at 8000 rpm for 5 min (Centrifuge 5430, Eppendorf), where the dissociated monomers or oligomers were separated and mainly located in the supernatant ...
-
bioRxiv - Biophysics 2023Quote: ... and applied 1,700 V for about 5 ms (Eppendorf Eporator, 4309000027). We quickly washed the cuvette with 500 μl SOC growth medium twice and cells were allowed to recover at 37 °C for 1 hour in a 50 ml conical tube (Corning ...
-
bioRxiv - Plant Biology 2024Quote: ... The seedlings were first placed in 5 mL tubes (Eppendorf #0030119460) and snap frozen in liquid nitrogen.
-
bioRxiv - Cell Biology 2024Quote: Cell culture maintenance incubator (37 °C, 5% CO2, humidified; Eppendorf CellXpert)
-
bioRxiv - Molecular Biology 2023Quote: ... The precipitate was eluted from the beads by shaking at 450 RPM at 65°C in a thermomixer (Eppendorf) overnight.
-
bioRxiv - Biochemistry 2024Quote: ... 200 µL of K562 cell lysates (2.5 mg/mL) was added to the beads and incubated at 4 °C on thermomixer (5382000023, Eppendorf) at 1,000 rpm for 2 hours ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: HEK-293T cells were cultured at 37 °C and 5% CO2 (Eppendorf). Cells were plated in 60 mm dishes and transfected with 1 ug of GFP-TAX4 and 3 ug of PEI-MAX per dish ...
-
bioRxiv - Neuroscience 2020Quote: ... Male heads were incubated for 5 min on a ThermoMixer (Eppendorf 5382000023), and 25 min in a rotating hybridization oven ...
-
Proteome Profiling of Cerebrospinal Fluid Reveals Novel Biomarker Candidates for Parkinson’s DiseasebioRxiv - Systems Biology 2021Quote: ... samples were shaken for 5 min at 2,000 rpm (thermomixer C, Eppendorf). Peptide concentrations were measured optically at 280nm (Nanodrop 2000 ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were then placed in 5 mL snap-cap tubes (Eppendorf 0030119401) in 3 mL wash medium supplemented with 0.2 U/mL collagenase A ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated for 5 min at 70 °C in ThermoMixer® (Eppendorf).
-
bioRxiv - Systems Biology 2023Quote: The mixtures were transferred to 5 mL reaction tubes (Eppendorf, Hamburg, Germany) and spun at max ...
-
bioRxiv - Developmental Biology 2024Quote: ... All cell centrifugations were done at 1800 rpm for 5 minutes (Eppendorf). Cells were resuspended in 200 µL of cold PBS and then 1 mL of 4% PFA was added then incubated ...
-
bioRxiv - Immunology 2023Quote: ... Pellets were placed in 5 ml microcentrifuge tubes (Eppendorf™, Hamburg, Germany) and their weight determined to calculate the eggs per gram of feces (EPG) ...
-
bioRxiv - Microbiology 2024Quote: ... and 85℃ for 5 minutes in a thermocycler (Mastercycler® Pro, Eppendorf). After cooling on ice ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 mL overnight cultures were pelleted using a 5810-R centrifuge (Eppendorf) at 800 x g for 5 minutes ...
-
bioRxiv - Immunology 2024Quote: ... Tissue powder was weighed (5-20mg in dry-ice-precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...