Labshake search
Citations for Eppendorf :
51 - 100 of 467 citations for 8 Chloro pyrido 3 4 b pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... in a Realplex 4 PCR machine (Eppendorf), and values were normalized to rpl-32 as an internal control ...
-
bioRxiv - Biophysics 2022Quote: ... and a micro-manipulator (Injectman 4; Eppendorf). Injection pipettes were prepared from siliconized (Sigmacote ...
-
bioRxiv - Cell Biology 2023Quote: ... in a realplex 4 qPCR cycler (Eppendorf). To calculate the relative mtDNA levels ...
-
bioRxiv - Biophysics 2021Quote: ... in particular to adjust reactions volumes to the 8- or 12-channel pipettes (Eppendorf, Hamburg, Germany), repetitive pipette HandyStep (Brand ...
-
bioRxiv - Molecular Biology 2019Quote: ... Phenol-chloroform (50:50) was added and cells were vortexed for 8 min (Eppendorf mixer 5432). The DNA was ethanol precipitated and resuspended in 40-50 µL TE (10 mM Tris ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were eluted with 60 μL of buffer B (80% ACN, 0.1% formic acid in H20) and reduced in a Vacufuge plus (Eppendorf) to a final volume of 3 μL ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were immediately cooled on ice and centrifuged for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The cell pellets were stored at −20°C until RNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... The cells were transferred into anaerobic 50 mL reaction tubes inside the anaerobic chamber and harvested outside of the anaerobic chamber for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The supernatant was discarded inside the anaerobic chamber and the pellet was resuspended in fresh RCM medium to an OD600 of 5-10 ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Bioengineering 2019Quote: For extract preparation each 4 mL of cell cultures from tp 48h of HDC run 1 were spun down for 10 min at 4000 g and 4 °C (Centrifuge 5804R, Rotor A-4-44, Eppendorf). Pellets were resuspended in fresh 1 mL ‘thylakoid buffer’ (50 mM HEPES-NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... and InjectMan®4 micromanipulator (Cat#. 5192000035, Eppendorf) using external continuous pressure ...
-
bioRxiv - Immunology 2021Quote: ... at 10.000 rpm and 4°C (Eppendorf 5804R), for the removal of residual titanium [16].
-
bioRxiv - Cell Biology 2022Quote: ... for 10 minutes at 4°C (Eppendorf, Germany), and supernatants were transferred into fresh tubes to be evaporated to dryness in a CentreVap concentrator at 40°C (Labconco ...
-
bioRxiv - Bioengineering 2024Quote: ... 15 min at 4°C (Eppendorf, Hamburg, Germany). duRNA was generated through equimolar annealing of trRNA/crRNA in duplex buffer (IDT) ...
-
bioRxiv - Biochemistry 2023Quote: ... placed on an orbital shaker platform rotating at 125 rpm at 37 °C with 8 % CO2 (Eppendorf). On the day of transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was pelleted down by centrifugation at 4°C at 1258 g for 5 min (Eppendorf #A-4-81 rotor) and washed with 25 ml ice-cold binding buffer [10 mM imidazole ...
-
bioRxiv - Cell Biology 2021Quote: ... were mixed and injected into the cytoplasm of fertilized eggs in a droplet of HEPES-CZB medium containing 5ug/ml cytochalasin B (CB) using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Developmental Biology 2023Quote: ... were mixed in HEPES-CZB medium containing 5 μg/ml cytochalasin B (CB) and injected into the cytoplasm of fertilized eggs using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Genomics 2024Quote: ... 3uL of SL-B reagent (BioSkryb Genomics, USA) was deposited in each well of a LoBind twin.tec PCR plate (Eppendorf, Germany) prior to sorting ...
-
bioRxiv - Biochemistry 2022Quote: Wholemeal flour samples were weighed (~8 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf), each well containing 20 μL of DMSO and a 3 mm glass ball to improve mixing ...
-
bioRxiv - Biochemistry 2023Quote: ... 380 μL samples of 8 μM aSyn solutions were incubated in Protein LoBind polypropylene tubes (Eppendorf, ref.0030108.116) at 37 °C under quiescent conditions over 10 days in the absence and presence of a cylindrical 10 mm x 3mm Teflon stirring bar (Merck ...
-
bioRxiv - Biophysics 2020Quote: ... The cell suspension was subsequently centrifuged for 30 min at 4°C and 3250 × g (Eppendorf Swing-bucket rotor A-4-62). The supernatant was discarded ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 10 sec (5424-R Eppendorf microfuge) and the pellet was resuspended with 400 μl TES Solution (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 20°C for 4 hours (Thermomixer 5355 R, Eppendorf). After incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in a Realplex 4 Thermocycler (Eppendorf) using the following program ...
-
bioRxiv - Immunology 2024Quote: ... on a MasterCycler EP Realplex 4 thermal cycler (Eppendorf) in 96-well-plate format ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). The compensation pressure set on the FemtoJet was 35hPa for the whole injection experiment to avoid damages on cells ...
-
bioRxiv - Biophysics 2022Quote: ... The probe was controlled with a micromanipulator (Injectman 4; Eppendorf) and mounted on an inverted epifluorescent microscope.
-
bioRxiv - Physiology 2023Quote: ... for 1 h at 4 □ on a ThermoMixer C (Eppendorf), 350 µl of water and 250 µl of chloroform were added to the mixture to induce phase separation ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the remaining blood cells from the plasma.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Immunology 2021Quote: ... Resulting cDNA was diluted 1:8 and subjected to endpoint RT-PCR using Taq DNA Polymerase (GeneDirex Inc., Taoyuan, Taiwan) in a Mastercycler Nexus (Eppendorf) or Bio-Rad T100 thermocycler ...
-
bioRxiv - Microbiology 2019Quote: ... Two hundred microliters of supernatant were transferred to tubes containing 8 µL neutralization solution (15% NH4HCO3) and dried in a Vacufuge concentrator (Eppendorf) for 30 to 45 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The citrated blood was mixed by gentle inversion and 8 mL was transferred to a 15 mL LoBind conical tube (Eppendorf), then placed in a heated water bath set to 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... with 200 μL of 3.2 mm round beads at for 10 min at setting 8 in 1.8 mL microcentrifuge vials (Eppendorf Safe-Lock). Homogenates were transferred to a new microcentrifuge vial and briefly placed on ice for phase separation before centrifugation at 14,000 × g for 15 minutes ...
-
bioRxiv - Biochemistry 2020Quote: ... frozen leaves were extracted in 50 mM P buffer (pH 7.5) at a ratio of 1:8 (w/v) and centrifuged (Eppendorf 5417R) twice at 18,000g for 20 min ...
-
bioRxiv - Microbiology 2023Quote: ... one of the aggregated cultures was transferred to a reagent reservoir (VistaLab Technologies) and mixed 50 times with an 8-channel micropipette (Eppendorf Xplorer ...
-
bioRxiv - Microbiology 2019Quote: ... four 50 mL aliquots from each trap were centrifuged at 3214 x g and 4°C for 30 minutes (Eppendorf 5810 R, S-4-104 rotor). The supernatant was decanted after centrifugation and cell pellets were stored at −80°C until ready for freeze-drying and lipid extraction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2019Quote: ... Loaded microfluidic chambers were centrifuged 3 min at 1000 rcf (Eppendorf centrifuge 5430R) to maximize cell adhesion.
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Neuroscience 2022Quote: ... Half medium was changed every 2-3 days using Xplorer multichannel pipettes (Eppendorf) set at lowest speed to not disturb the hostdonor interaction ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were centrifuged (20 min, 15,000g, 4°C, in an Eppendorf 5810R centrifuge ...