Labshake search
Citations for Eppendorf :
51 - 100 of 1042 citations for 6 Chloro 2 methyl 1 2 4 triazolo 4 3 b pyridazin 3 2H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... centrifuged (16000 g, 3 min, 5415R, Eppendorf) and re-suspended in fresh medium ...
-
A DNA-based optical nanosensor for in vivo imaging of acetylcholine in the peripheral nervous systembioRxiv - Bioengineering 2020Quote: The DNA scaffold was self-assembled by incubating 5 DNA oligonucleotides following a temperature gradient from 95 °C to 4 °C for 6 h in a thermocycler (Mastercycler® nexus X2, Eppendorf) in Tris-EDTA buffer (TE buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... and rotor (Eppendorf #S-4-72). Upon end of centrifugation ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). Proteins in the clear supernatant (protein extract ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). 15 µg of recombinant FAMOSS-streptavidin/streptavidin was added to supernatant and incubated 1h on ice with rotation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... in a MasterCycler RealPlex 4 (Eppendorf). Each 20 μL qPCR reaction contained 90 ng of cDNA ...
-
bioRxiv - Biophysics 2023Quote: ... with a micromanipulator InjectMan 4 (Eppendorf). The injection needles Femtotip II (Eppendorf ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Genomics 2023Quote: ... and centrifuged at 3,200 g and 4°C using a swinging-bucket rotor (Eppendorf A-4-81) for 5 mins ...
-
bioRxiv - Cell Biology 2019Quote: ... The lysate was centrifuged at 4°C at 3220 g for 15 min (Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Neuroscience 2019Quote: ... and lyophilized for 2h in an Eppendorf concentrator (Eppendorf) and stored at −80°C until use.
-
bioRxiv - Immunology 2020Quote: ... (Eppendorf Centrifuge 5810R, rotor A-4-62) at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... in a Realplex 4 PCR machine (Eppendorf), and values were normalized to rpl-32 as an internal control ...
-
bioRxiv - Biophysics 2022Quote: ... and a micro-manipulator (Injectman 4; Eppendorf). Injection pipettes were prepared from siliconized (Sigmacote ...
-
bioRxiv - Cell Biology 2023Quote: ... in a realplex 4 qPCR cycler (Eppendorf). To calculate the relative mtDNA levels ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Cell Biology 2020Quote: ... This isolation method included a penultimate centrifugation step in Eppendorf polypropylene conical tubes (10,000 x g for 30 min at 4°C, in Eppendorf rotor F-34-6-38) that allowed the removal/isolation of larger microvesicles ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were immediately cooled on ice and centrifuged for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The cell pellets were stored at −20°C until RNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... The cells were transferred into anaerobic 50 mL reaction tubes inside the anaerobic chamber and harvested outside of the anaerobic chamber for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The supernatant was discarded inside the anaerobic chamber and the pellet was resuspended in fresh RCM medium to an OD600 of 5-10 ...
-
bioRxiv - Genomics 2019Quote: ... incubated for 5 min at 4 °C with rotation and pelleted again (500 x g, 5 min, 4°C; 5920R, Eppendorf). Nuclei were resuspended in 500 μL high salt tagmentation buffer (36.3 mM Tris-acetate (pH = 7.8) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Cell Biology 2022Quote: ... and InjectMan®4 micromanipulator (Cat#. 5192000035, Eppendorf) using external continuous pressure ...
-
bioRxiv - Immunology 2021Quote: ... at 10.000 rpm and 4°C (Eppendorf 5804R), for the removal of residual titanium [16].
-
bioRxiv - Cell Biology 2022Quote: ... for 10 minutes at 4°C (Eppendorf, Germany), and supernatants were transferred into fresh tubes to be evaporated to dryness in a CentreVap concentrator at 40°C (Labconco ...
-
bioRxiv - Bioengineering 2024Quote: ... 15 min at 4°C (Eppendorf, Hamburg, Germany). duRNA was generated through equimolar annealing of trRNA/crRNA in duplex buffer (IDT) ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was pelleted down by centrifugation at 4°C at 1258 g for 5 min (Eppendorf #A-4-81 rotor) and washed with 25 ml ice-cold binding buffer [10 mM imidazole ...
-
bioRxiv - Immunology 2022Quote: ... Purified IgG was digested into F(ab’)2 with 200 μg of IdeS per 10 mg of IgG for 6 hr on a thermal mixer (Eppendorf ThermoMixer C) at 37°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.01% Tween 20) for 1 h at 4 °C and 1200 rpm in a thermomixer (Eppendorf). Unbound protein was removed by washing 2x with high salt buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Biophysics 2020Quote: ... The cell suspension was subsequently centrifuged for 30 min at 4°C and 3250 × g (Eppendorf Swing-bucket rotor A-4-62). The supernatant was discarded ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 10 sec (5424-R Eppendorf microfuge) and the pellet was resuspended with 400 μl TES Solution (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 20°C for 4 hours (Thermomixer 5355 R, Eppendorf). After incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in a Realplex 4 Thermocycler (Eppendorf) using the following program ...
-
bioRxiv - Immunology 2024Quote: ... on a MasterCycler EP Realplex 4 thermal cycler (Eppendorf) in 96-well-plate format ...
-
bioRxiv - Molecular Biology 2019Quote: ... using a Realplex 2 thermocycler (Eppendorf). The PCR conditions were 95°C for 3 min ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Biochemistry 2020Quote: ... The rest of the solution was incubated at 4 °C for 1 h on a thermomixer (Eppendorf) set to 1000 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell debris was removed via centrifugation at 13,000g for 1 hour at +4°C (Eppendorf 5810r centrifuge). A 1 ml HisTrap FF Crude chromatography column (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... diluted 1:250 in 500ul PBSFBT either ON or for 2h at 32°C in a heating block (ThermoMixer C, Eppendorf) with integrated shaking (350rpm) ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). The compensation pressure set on the FemtoJet was 35hPa for the whole injection experiment to avoid damages on cells ...
-
bioRxiv - Biophysics 2022Quote: ... The probe was controlled with a micromanipulator (Injectman 4; Eppendorf) and mounted on an inverted epifluorescent microscope.
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the remaining blood cells from the plasma.