Labshake search
Citations for Eppendorf :
51 - 100 of 904 citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Destained gel bands were first cut into small cubes (1-2 mm in each dimension) using a clean scalpel and transferred to new LoBind tubes (Eppendorf). Gel cubes were dehydrated by incubating in 500 μL acetonitrile (ACN ...
-
bioRxiv - Genetics 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passes (1 + 17, 2 + 18 … etc.) and dried in a Speed-Vac (Eppendorf).
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, pooled in two passes (fraction 1 + 17, fraction 2 + 18,…, etc.) and dried in a vacuum centrifuge (Eppendorf).
-
bioRxiv - Cell Biology 2022Quote: ... Fractions were collected every three minutes, and fractions were pooled in two passed (1 + 17, 2 + 18 … etc.) and dried in a vacuum centrifuge (Eppendorf). Dried fractions were resuspended in 0.1% formic acid and analyzed on a Orbitrap Lumos Tribrid mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... benthamiana leaf tissue 5-days post Agrobacterium infiltration was collected using a leaf disc cutter 1 cm in diameter and placed inside a 2 mL safe-lock tube (Eppendorf). Each biological replicate consisted of 4 leaf discs from the same leaf (approximately 40 mg fresh weight) ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial mixtures were diluted 1:1000 into LB with or without 1% DMSO (v/v) and incubated standing at 37°C in 5% CO2 at atmospheric oxygen (normoxic; Eppendorf CellXpert incubator), 1% oxygen (hypoxic ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were diluted with sterile 1x PBS to 10 µg/mL (according to the manufacturer’s recommendation) in the volume of 5 mL in 5-mL Protein LoBind tubes (Eppendorf). For chip assays ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Microbiology 2024Quote: ... transferred to 2-ml tubes (Eppendorf), harvested by centrifugation at 7000 x g for 7 minutes and stored at –80°C until DNA isolation (see below).
-
bioRxiv - Biochemistry 2024Quote: ... (2) 200 μL pipette (Eppendorf, Germany), (3 ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Microbiology 2024Quote: ... a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Microbiology 2021Quote: ... Bacillus cereus group isolates’ inocula were prepared from overnight cultures (see “Bacterial cultures” section) by adjusting their concentration to 1-2 × 108 CFU/ml using a spectrophotometer (Eppendorf BioPhotometer 6131). A previously established OD-CFU standard curve was used to estimate the CFU/ml based on the OD reading ...
-
bioRxiv - Genetics 2024Quote: ... placed in an injection arena (9 cm-diameter Petri dish containing a layer of 1% agarose) and injected with ∼60 ng of Pmtra-2 or EGFP dsRNA (negative control) using a FemtoJet microinjector (Eppendorf, Hamburg, Germany). Injectees were maintained in a two-ounce plastic cup with corn leaves until they became adults ...
-
bioRxiv - Neuroscience 2023Quote: ... A total of 1800 µl of solution from both tubes (batch 1) were transferred to a 2 ml Eppendorf and vortexed (Eppendorf Thermomixer C) for 15 minutes at 2000 rpm (4 °C) ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were prepared in 96 well microtiter plates by adding 12.5 μL reaction supernatant to 50 μL acetonitrile with 1% v/v trifluoroacetic acid (TFA) followed by centrifugation (2,204 g, 30 min; A-2-DWP rotor, Eppendorf AG, Hamburg, Germany) and transferring of 50 μL centrifugation supernatant into 150 μL MilliQ H2O ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmid injection solution was injected into Hydra vulgaris AEP 1-cell stage embryos using an Eppendorf FemtoJet 4x and Eppendorf InjectMan NI 2 microinjector (Eppendorf; Hamburg, Germany) under a Leica M165 C stereo microscope (Leica Microscopes ...
-
bioRxiv - Zoology 2024Quote: ... and sgRNA (150 ng/μL) was co-injected into embryos (<1 hr-old) using the InjectMan NI 2 microinjection system (Eppendorf, Hamburg, Germany). Injected eggs were incubated at 26 ± 1 °C and 70% ± 5% relative humidity for hatching.
-
bioRxiv - Developmental Biology 2024Quote: ... The cells were washed with cold staining buffer (1× PBS, 0.2% BSA and 5 mM glucose) and spun down at 150 × g with low brake (Eppendorf Centrifuge 5810 R, Hamburg, Germany). The cell number was counted using a hemocytometer ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a RealPlex 2 thermocycler (Eppendorf, 2894). All primers were designed and purchased from Integrated DNA Technologies and their sequences are listed in Supplementary file 1.
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Microbiology 2024Quote: ... For −80°C and −20°C, spore suspensions (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) were directly exposed to either of the two temperatures for two weeks ...
-
bioRxiv - Cancer Biology 2021Quote: ... 30-70 kDa lane portions were excised into 2×2 mm cubes and transferred to Protein Lo-Bind tubes (Eppendorf). Excised gels were partitioned into tubes ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissues were fixed in 2% paraformaldehyde for 55 minutes at room temperature in 2 mL Protein LoBind tubes (Eppendorf 022431064). Fixative was removed and tissues were washed 4x 10 minutes with 1.5 mL PBS with 0.5% Triton X-100 (PBT) ...
-
bioRxiv - Microbiology 2024Quote: ... As a control, a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Cell Biology 2021Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Immunology 2021Quote: ... and collected into sterile 2 ml tubes (Eppendorf). All samples were immediately snap frozen in dry ice and stored at –80 °C until DNA extraction.
-
bioRxiv - Plant Biology 2023Quote: ... in individual 2 mL safe-lock tubes (Eppendorf). The suspensions were briefly vortexed to homogeneity and incubated at room temperature for 2 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... connected to a 2 ml microcentrifuge tube (Eppendorf) with an air-tight metal tube cap (P-CAP 2 mL High Pressure ...
-
bioRxiv - Synthetic Biology 2023Quote: ... transferred into 2 mL reaction tubes (Eppendorf, Germany), and frozen at −20 ℃ until further use ...
-
bioRxiv - Biochemistry 2023Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Plants (3 plants in 2 mL Eppendorf tubes) were harvested at Zeitgeber time (ZT ...
-
bioRxiv - Cell Biology 2024Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Biophysics 2024Quote: ... in 2 mL Protein Lo Bind Tubes (Eppendorf) using the following protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... in individual 2 mL safe-lock tubes (Eppendorf). The suspensions were briefly vortexed to homogeneity and incubated at room temperature for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...