Labshake search
Citations for Eppendorf :
51 - 100 of 981 citations for 4R 5S 2 5 Fluoropyridin 2 yl 4 5 diphenyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: ... were added without disturbing the pellet and nuclei were pelleted with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed without disturbing the pellet and leaving ∼2-3 µl behind ...
-
bioRxiv - Systems Biology 2023Quote: ... and incubated on ice for 1 min before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Pathology 2023Quote: ... The samples were extracted overnight at 4℃ and then centrifuged at 4,000 rpm for 5 min at 4°C using a 5810 R fixed-angle rotor centrifuge (Eppendorf, Germany). 1 ml of the upper layer of petroleum ether was dried under vacuum in a new 2-ml tube ...
-
bioRxiv - Molecular Biology 2024Quote: ... After The upper lipophilic phases and lower hydrophilic phases were separated by high-speed centrifugation (12,700 rpm, 5 min at 4 °C, Centrifuge 5430R, Eppendorf, Germany). Next ...
-
bioRxiv - Genomics 2024Quote: ... was added without disturbing the pellet and nuclei were pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). The supernatant was removed without disturbing the pellet and 7-10 µl of 1x Nuclei Buffer (10x Genomics ...
-
bioRxiv - Genomics 2024Quote: ... and incubated on ice for 1 minute before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). The supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were washed with cold 70% ethanol and centrifuged at 19,000 × g for 5 min at 4°C and air dried for 15 min in the Centrifugal Vacuum Concentrator 5301 (Eppendorf, USA). The quality of RNA was assessed using a NanoDrop (ND-1000 ...
-
bioRxiv - Microbiology 2024Quote: ... The stationary pre-cultures were then pooled and washed by centrifugation (5 min, 3,220 g and 4 °C) using a 5810 R swing-out centrifuge (Eppendorf, Hamburg, Germany). After centrifugation ...
-
bioRxiv - Cell Biology 2023Quote: ... a micromanipulator system (Eppendorf, TransferMan 4r), and a CMOS high speed camera (Vision Research ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 % CO2 using microloaders (Eppendorf). Slices were placed into the incubation chambers one at a time (minimum volume 1.5 ml to cover raised grid) ...
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Cell Biology 2020Quote: ... and the cells were pelleted by centrifugation at approximately 250 × g for 5 min at 4 °C (Eppendorf 5804 R, Hamburg, Germany). After resuspension ...
-
bioRxiv - Plant Biology 2024Quote: ... The supernatant was collected after centrifugation at 4 °C for 5 min at 5000 g and dried using a SpeedVaq (Eppendorf, Montesson, France). Then ...
-
bioRxiv - Immunology 2024Quote: ... stool suspensions of feces (in H2O) were centrifuged at 16000 rpm and 4°C for 5 min using an Eppendorf 5427R centrifuge (Eppendorf; Hamburg, Germany). 100 µL of supernatant were mixed with 400 µL of ice-cold methanol containing recovery standards for evaluation of the quality of cell harvest and correction for variations ...
-
bioRxiv - Immunology 2024Quote: ... Before preparation for LC-MS analysis each sample was centrifuged at 16000 rpm and 4°C for 5 min using an Eppendorf 5427R centrifuge (Eppendorf; Hamburg, Germany). From each supernatant 350 µL were pipetted into two separate LC vials ...
-
bioRxiv - Microbiology 2024Quote: ... The NPA positive was diluted in 2 ml of MEM without FBS and centrifuged at 200Xg for 5 min (HSR Centrifuge Eppendorf Presvac) (NPA supernatant) ...
-
bioRxiv - Cell Biology 2023Quote: ... transferred in 5 ml tubes (Eppendorf) and 480 μl Triton-X-100 (2% [vol/vol] final concentration ...
-
bioRxiv - Biophysics 2021Quote: ... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were diluted to 2 x 107 cells per mL and 50 µL of each sample was added to 5 mL tubes (Eppendorf, Hamburg, DE), to constitute 1 million cells per flow sample.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... a mixture of the antibody constructs with a 10-fold molar excess of DFO*-NCS (5 mg/mL in DMSO) (ABX, Radeberg, Germany) was incubated ON at 4 °C with gentle shaking (Eppendorf ThermoMixer, Merck, Darmstadt, Germany). The DFO*-derivatized constructs were purified by SE-HPLC under the same conditions as described above.
-
bioRxiv - Microbiology 2022Quote: Cells (2 ml cultures) were spun down (30 s Eppendorf centrifuge, 14,000 rpm, 4 °C), resuspended in 0.4 ml ice-cold growth medium and added to a screw cap Eppendorf tube containing 1.5 g glass beads (0.1 mm) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were loaded into a microinjection needle and 50 nL of the ZMEL cell suspension was transplanted into the hindbrain ventricle of anesthetized 2 dpf zebrafish larvae by using an oil-controlled microinjection rig (Eppendorf CellTram 4r Oil, #5196000030) with a Narishige arm ...
-
bioRxiv - Biophysics 2020Quote: ... Supplementary Table 5) were incubated together for 2 h at 37 °C under gentle shaking (450 rpm, Eppendorf ThermoMixer® C, Eppendorf AG, Germany). Unbound DNA origami was removed by placing the tube on a magnet and discarding the supernatant ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were diluted with sterile 1x PBS to 10 µg/mL (according to the manufacturer’s recommendation) in the volume of 5 mL in 5-mL Protein LoBind tubes (Eppendorf). For chip assays ...
-
bioRxiv - Plant Biology 2021Quote: ... together with an Eppendorf Transferman 4r micromanipulator (Eppendorf AG) and VacuTip II microcapillaries (Eppendorf ...
-
bioRxiv - Genetics 2024Quote: ... using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). Following the microinjection ...
-
bioRxiv - Cell Biology 2024Quote: ... using a micromanipulator TransferMan 4r and FemtoJet 4i (Eppendorf). Following the microinjection ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 times for 5 seconds each to ensure homogenization and centrifuged at 14000 x g for 10 minutes at 4° C (Eppendorf centrifuge 5424 R, FA-45-24-11 rotor). Supernatant was precleared by rotating 20 µl Protein A agarose beads (Cell Signaling #9863 ...
-
bioRxiv - Biophysics 2024Quote: ... connected to a pressure controller (CellTram 4r Air/Oil, Eppendorf), which was mounted on a three-axis micromanipulator (Transferman 4R ...
-
bioRxiv - Biophysics 2020Quote: ... with three ssDNA overhang strands on a bottom partially complementary to the sequence on the magnetic beads (mag2, Supplementary Table 5) were incubated together for 2 h at 37 °C under gentle shaking (450 rpm, Eppendorf ThermoMixer® C, Eppendorf AG, Germany). Unbound DNA origami was removed by placing the tube on a magnet and discarding the supernatant ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The homogenate was further incubated on ice for 45 min before centrifugation at 21,000 g and 4°C for 2 x 10 min in an Eppendorf 5424 R benchtop centrifuge (Eppendorf). Protein content of the lysate was determined by BCA assay (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... and tubes centrifuged at 4 °C for 2 min at 12000 x g in a refrigerated microfuge (Eppendorf 5415R). The upper phase was discarded ...
-
bioRxiv - Biophysics 2024Quote: ... which was mounted on a three-axis micromanipulator (Transferman 4R, Eppendorf). After a drop of cells was placed within the petri dish containing the stretchers ...
-
bioRxiv - Biophysics 2024Quote: The treated pipettes were inserted into a TransferMan 4r micromanipulator (Eppendorf) mounted on a confocal microscope (Eclipse Ti2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).