Labshake search
Citations for Eppendorf :
51 - 100 of 773 citations for 1 4 Bromo 3 methylphenyl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, Eppendorf #A-4-81 rotor) to remove intact cells and debris ...
-
bioRxiv - Genomics 2023Quote: ... and centrifuged at 3,200 g and 4°C using a swinging-bucket rotor (Eppendorf A-4-81) for 5 mins ...
-
bioRxiv - Plant Biology 2024Quote: ... SDS at a 1:3 (w/v) ratio and extracted by shaking 1000 RPM 95 °C for using a tabletop shaker (Eppendorf ThermoMixer F2.0). Samples were then centrifuged at 20,000 xg for 10 min at room temperature and the supernatant retained in new tubes ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Bioengineering 2020Quote: ... and microbubbles were isolated by 4 centrifugation wash cycles at 40 relative centrifugation force for 1 min (Eppendorf 5804, Hamburg, Germany), where the infranatant was discarded and the microbubble concentrate was saved and resuspended.
-
bioRxiv - Microbiology 2024Quote: ... The crude EV fractions were prepared by ultracentrifugation (45,000 rpm, 1 h, 4°C; S50A rotor, Himac Ultracentrifuge CS100GXII; Eppendorf Himac Technologies) of the thus prepared supernatants.
-
bioRxiv - Bioengineering 2023Quote: ... Cells were stained for 1 hour at a temperature of 4°C with shaking at 600 rpm in a Thermomixer comfort (Eppendorf, Germany). Stained cells were washed with ice cold FACS buffer twice before resuspension in FACS buffer for analysis ...
-
bioRxiv - Cell Biology 2024Quote: ... The protoplasts were collected by centrifugation at 1700 rpm for 1 minute using a swing-bucket rotor (Eppendorf S-4-72), washed with 15 mL of ice-cold solution 3 (26.4 g of ammonium sulfate ...
-
bioRxiv - Microbiology 2024Quote: ... An overnight culture of 1 ml was pelleted down by centrifugation ((10,000 rpm at 4°C for 10 min; Eppendorf centrifuge 5810R) and washed thrice with M9 minimal (M9M ...
-
bioRxiv - Immunology 2020Quote: ... (Eppendorf Centrifuge 5810R, rotor A-4-62) at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... in a Realplex 4 PCR machine (Eppendorf), and values were normalized to rpl-32 as an internal control ...
-
bioRxiv - Biophysics 2022Quote: ... and a micro-manipulator (Injectman 4; Eppendorf). Injection pipettes were prepared from siliconized (Sigmacote ...
-
bioRxiv - Cell Biology 2023Quote: ... in a realplex 4 qPCR cycler (Eppendorf). To calculate the relative mtDNA levels ...
-
bioRxiv - Molecular Biology 2024Quote: Centrifuge rotor A-4-62 (Eppendorf, 022638009)
-
bioRxiv - Cell Biology 2024Quote: ... and a micro-manipulator (Injectman 4, Eppendorf). Injection needles were prepared from siliconized (Sigmacote ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Injection was performed with InjectMan 4 (Eppendorf) and Eppendorf femtotips using an Olympus IX71 microscope ...
-
bioRxiv - Cell Biology 2024Quote: ... with A-4-81 Rotor (Eppendorf, Germany) to remove the dead cells and cell debris ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysate was centrifuged at 4°C (3220 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) to remove intact cells and debris ...
-
bioRxiv - Immunology 2022Quote: ... 20 μL of mAb solution was added to the cells in the filter wells and the cells were incubated for 1 h at 4 °C and 750 RPM on a thermomixer (Eppendorf, ThermoMixer C). After the incubation ...
-
bioRxiv - Microbiology 2023Quote: Liquid samples in 1 ml were collected and centrifuged for 20 min at 21 130 × g at 4°C (Centrifuge 5424 R; Eppendorf, Hamburg, Germany). The supernatants were used for chemical analyses by applying external standards for calibration and quality control ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1:1v/v mixture of 33% ammonium hydroxide and 40% methylamine in water for 3 h at 37 °C (Eppendorf ThermoMixer C, 1000 rpm). The suspension was filtered ...
-
bioRxiv - Biochemistry 2020Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, Eppendorf #A-4-81 rotor) and washed with ice-cold 50 mL Binding buffer composed of 10 mM imidazole (pH 7.4) ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were immediately cooled on ice and centrifuged for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The cell pellets were stored at −20°C until RNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... The cells were transferred into anaerobic 50 mL reaction tubes inside the anaerobic chamber and harvested outside of the anaerobic chamber for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The supernatant was discarded inside the anaerobic chamber and the pellet was resuspended in fresh RCM medium to an OD600 of 5-10 ...
-
bioRxiv - Neuroscience 2024Quote: Suspensions were centrifuged at 4°C in 50 mL centrifuge tubes (Falcon) with a 5810R centrifuge and an A-4-81 rotor (Eppendorf) and in 38.5 mL polyallomer Ultra Clear ultracentrifuge tubes (Beckman Coulter ...
-
bioRxiv - Cell Biology 2022Quote: ... and InjectMan®4 micromanipulator (Cat#. 5192000035, Eppendorf) using external continuous pressure ...
-
bioRxiv - Immunology 2021Quote: ... at 10.000 rpm and 4°C (Eppendorf 5804R), for the removal of residual titanium [16].
-
bioRxiv - Cell Biology 2022Quote: ... for 10 minutes at 4°C (Eppendorf, Germany), and supernatants were transferred into fresh tubes to be evaporated to dryness in a CentreVap concentrator at 40°C (Labconco ...
-
bioRxiv - Bioengineering 2024Quote: ... 15 min at 4°C (Eppendorf, Hamburg, Germany). duRNA was generated through equimolar annealing of trRNA/crRNA in duplex buffer (IDT) ...
-
bioRxiv - Microbiology 2024Quote: ... or MasterCycler EP Realplex 4 thermal cycler (Eppendorf). Data were analyzed using recA and gyrA as internal controls ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2023Quote: ... at 4°C for 1 hour and centrifuged at 4°C at 14200 rpm for 50 min using a refrigerated table-top centrifuge (Eppendorf Centrifuge, Hamburg, Germany). The cleared lysates were loaded on wells of 96-well single-use filter micro-plates with 3 µm glass fibers and 25 µm polyethylene membranes (Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... The samples were then digested for 4 h at 37°C (1000 x rpm for 1 h, then 650 x rpm, Eppendorf ThermoMixer®C). Samples were then diluted 1:1 with milliQ water ...
-
bioRxiv - Biophysics 2020Quote: ... The cell suspension was subsequently centrifuged for 30 min at 4°C and 3250 × g (Eppendorf Swing-bucket rotor A-4-62). The supernatant was discarded ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 10 sec (5424-R Eppendorf microfuge) and the pellet was resuspended with 400 μl TES Solution (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 20°C for 4 hours (Thermomixer 5355 R, Eppendorf). After incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in a Realplex 4 Thermocycler (Eppendorf) using the following program ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C for 20 minutes (Eppendorf® 5418 R) to collect all the cells ...
-
bioRxiv - Genetics 2024Quote: ... 000 RPM for 10 minutes at 4°C (Eppendorf), followed by transfer of the plasma to tubes ...
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Biophysics 2021Quote: ... Lipid extracts were resuspended in 60 μl 10mM ammonium acetate in methanol and diluted 1:4 in 96-well plates (Eppendorf twin.tec® 96; Sigma-Aldrich) prior to measurement of PC species ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). The compensation pressure set on the FemtoJet was 35hPa for the whole injection experiment to avoid damages on cells ...
-
bioRxiv - Biophysics 2022Quote: ... The probe was controlled with a micromanipulator (Injectman 4; Eppendorf) and mounted on an inverted epifluorescent microscope.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the remaining blood cells from the plasma.
-
bioRxiv - Bioengineering 2024Quote: ... Homogenates were agitated at 4°C in a thermomixer (Eppendorf) for 2 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). Microinjection of cells were performed on an inverted microscope (Nikon Ti2 Eclipse ...
-
bioRxiv - Cell Biology 2024Quote: ... The probe was controlled with a micromanipulator (Injectman 4, Eppendorf), and mounted on an inverted epifluorescence microscope.