Labshake search
Citations for Eppendorf :
851 - 900 of 1086 citations for R 4 Benzyl 2 2 diphenylphosphino benzyl 4 5 dihydrooxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Microbiology 2021Quote: ... with 100 μl aliquot of the ultra-low gelling temperature agarose gel solution (6% in Mueller Hinton Broth II, cation-adjusted) to 85 °C in a Thermomixer (Eppendorf Thermomixer R Shaker, Eppendorf). Once the temperature was reached ...
-
bioRxiv - Biophysics 2021Quote: ... and the aggregated samples were pelleted via centrifugation at 20.000 g for 10 min (Eppendorf 5417 R table-top centrifuge). The pellets were washed with 500 μL ice-cold acetone and centrifuged for 5 min ...
-
bioRxiv - Bioengineering 2024Quote: ... the gel was further degassed using customized 10 mL syringes (Becton, Dickinson, and Company) with a syringe filter top centrifuged (5702 R, Eppendorf) for five minutes at 2500 rpm ...
-
bioRxiv - Microbiology 2022Quote: ... The filter centrifuge tubes containing the samples were centrifuged for 10 minutes at 12000 rpm (Eppendorf, 5424 R, 13523 ×g). After centrifugation ...
-
bioRxiv - Neuroscience 2022Quote: ... Particles were collected by centrifugation at 1000 xg for 10 minuntes (Eppendorf centrifuge 5864 R, Eppendorf North America, Hauppauge, NY) and washed three times by discarding the supernatant ...
-
bioRxiv - Microbiology 2024Quote: ... Aqueous phage was separated by centrifugation (14,000 rpm for 10 minutes at room temperature in 5418 R Centrifuge equipped with FA-45-18-11 rotor (Eppendorf)) ...
-
bioRxiv - Biophysics 2024Quote: ... and eluted by adding 1mL Buffer B to the cartridge and spinning in a swing bucket rotor (Eppendorf 5910 R) at 300rpm for 5 min ...
-
bioRxiv - Biophysics 2024Quote: ... and eluted by adding 1mL Buffer B to the cartridge and spinning in a swing bucket rotor (Eppendorf 5910 R) at 300rpm for 5 min ...
-
Scalable Fabrication of a Tough and Recyclable Spore-Bearing Biocomposite Thermoplastic PolyurethanebioRxiv - Bioengineering 2024Quote: ... Spores were further washed with PBS by repeating the following steps for three times: (i) centrifugation at 2200 g at 25 °C for 10 min (5810 R, Eppendorf), (ii ...
-
bioRxiv - Bioengineering 2024Quote: ... XC83.1) and centrifuged the samples for 6 min at 17,000 g in a benchtop centrifuge (5427 R, Eppendorf, Hamburg, Germany). We discarded the supernatant and stored the biomass pellets at -80°C until further analysis (as marked in Fig ...
-
bioRxiv - Cell Biology 2024Quote: ... and the remainder of the bacteria were harvested by 15 min centrifugation at 2683 ×g in a swing-out centrifuge (5810 R, Eppendorf). Supernatant was removed and 200 µL of lysis buffer (2% Deoxycholic acid in 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... and the remainder of the bacteria were harvested by 15 min centrifugation at 2683 ×g in a swing-out centrifuge (5810 R, Eppendorf). Supernatant was removed and 200 µL of lysis buffer (2% Deoxycholic acid in 50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell suspension was centrifuged at full speed (7,197 × g) at 20 °C for 10 minutes in a refrigerated centrifuge (cat. 5430 R, Eppendorf, Hauppauge, NY). The supernatant was discarded ...
-
bioRxiv - Plant Biology 2022Quote: ... cheesecloth in four layers were used to filter the mixtures and centrifuged for one hour at 3000 rpm in a centrifuge (5804/5804 R, Eppendorf, Germany). A single layer of Whatman No ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells and large debris were removed by low-speed sedimentation at 1,000xg for 15 min followed by medium-speed sedimentation at 10,000xg for 15 min in an Eppendorf 5430 R centrifuge (Eppendorf, Hamburg, Germany). Aliquots (200 µl ...
-
bioRxiv - Molecular Biology 2022Quote: ... added to a microcentrifuge tube and centrifuged at 1,000xg for 15 min in an Eppendorf 5430 R centrifuge (Eppendorf, Hamburg, Germany) to remove intact cells ...
-
bioRxiv - Genomics 2024Quote: ... The grown bacterial cells were subsequently centrifuged at 5000 G for 10 min using a 5920 R centrifuge (Eppendorf, Hamburg, Germany) washed in 1 mL 0.9% NaCl and subsequently centrifuged again at 12000 rpm for 3 min ...
-
bioRxiv - Biochemistry 2024Quote: ... The plate was then centrifuged at 1000 rpm for 30 s (5804/ 5804 R – Benchtop Centrifuge, Eppendorf North America, CT, USA), mixed on a plate shaker (Siemens DPC MicroMix 5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The expression profiles of shortlisted PPRs were analysed in sterile A-line and restorer R-lines using the Realplex Real-Time PCR system (Eppendorf, Germany) and SYBR Green mix (Bioline ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ml of 108 PFU was centrifuged at 20,000 g (centrifuge 5430 R, rotor FA- 45-24-11HS; Eppendorf, Hamburg, Germany) for 2h at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... 1 ml of 108 PFU was centrifuged at 20,000 g (centrifuge 5430 R, rotor FA-45-24-11HS; Eppendorf, Hamburg, Germany) for 2h at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... To load a coverslip with nuclei the nuclei suspension was pipetted into the well containing a coverslip and centrifuged at 1,000 g for 10 min at RT using a swing-bucket rotor (Eppendorf Centrifuge 5810 R). The supernatant can be re-used for additional coverslips.
-
Sex-specific fear acquisition following early life stress is linked to amygdala glutamate metabolismbioRxiv - Animal Behavior and Cognition 2024Quote: ... the samples were centrifuged at 13 000 rpm for 10 min at 10°C with Centrifuge 5424 R (Eppendorf AG, Hamburg, Germany). The clear supernatant was transferred to a 1.5 mL glass vial with insert ...
-
bioRxiv - Bioengineering 2023Quote: ... The recovered spores were washed by repeating the following steps for three times: (i) centrifugation at 4000 rpm at 25 °C for 10 min (5810 R, Eppendorf, Hamburg, Germany), (ii ...
-
bioRxiv - Biophysics 2023Quote: ... The blood was centrifuged at 250 RCF (relative centrifugal force) and 7 rad/s2 acceleration for 20 min (5810 R, Eppendorf, Hamburg, Germany). The platelet rich plasma (PRP ...
-
bioRxiv - Bioengineering 2024Quote: Coating formulations were prepared by dissolving the lyophilized protein powder in MilliQ water to the final concentration of 0.01 - 10 g/L and then centrifuged for 10 min at 10000 rpm (Eppendorf Centrifuge 5430 R). The supernatant was taken for surface coating.
-
bioRxiv - Neuroscience 2020Quote: We transferred 5 dpf larvae to 1.5 ml centrifuge tubes (Eppendorf). All fish water was aspirated and replaced with 1.0 ml 4% paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... volume was reduced to 5 μL in a Speedvac concentrator (Eppendorf) and sequencing libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina) ...
-
bioRxiv - Bioengineering 2021Quote: ... dissected brains were placed in 5 ml tubes (Eppendorf, 0030 119.401) and covered with 4.5 mL of clearing solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 5 min at 37 °C under agitation (Eppendorf, ThermoMixer C). Lobes were pipetted to promote dissociation ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were centrifuged at 272g for 5 minutes (Eppendorf 5810R) at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... and centrifuged at 8000 rpm for 5 min (Centrifuge 5430, Eppendorf), where the dissociated monomers or oligomers were separated and mainly located in the supernatant ...
-
bioRxiv - Biophysics 2023Quote: ... and applied 1,700 V for about 5 ms (Eppendorf Eporator, 4309000027). We quickly washed the cuvette with 500 μl SOC growth medium twice and cells were allowed to recover at 37 °C for 1 hour in a 50 ml conical tube (Corning ...