Labshake search
Citations for Eppendorf :
751 - 800 of 1012 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... Eppendorf 1 mL Protein LoBind 96-well plates (P/N 951033308) were purchased from Eppendorf (Enfield, CT, USA). Corning plate lids (P/N CLS3935-50EA ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3-6 pooled tissue biopsies were moved into a precooled 1.5 mL tube (Eppendorf, Germany) containing 300µL digestion cocktail consisting of Gibco RPMI 1640 (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were diluted with sterile 1x PBS to 10 µg/mL (according to the manufacturer’s recommendation) in the volume of 5 mL in 5-mL Protein LoBind tubes (Eppendorf). For chip assays ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Cell Biology 2024Quote: ... Huh7 cells were grown in 24-well glass bottom plates (170 μm coverglass bottom; Eppendorf, 0030741021; Cellvis, P24-1.5H-N). Cells were either untreated or incubated in 100 μM oleate-BSA complex for 24 hr ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and then 6 mL of the culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at room temperature.
-
bioRxiv - Microbiology 2024Quote: An agar plug (6 mm diameter) of the bacterial culture was transferred to a vial (Eppendorf) and extracted with 1 mL of isopropanol ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a 6 mL portion of each cell culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Cell Biology 2023Quote: ... GEMRT was performed in a Bio-Rad PTC-200 Thermal Cycler with semi- skirted 96-Well Plate (Eppendorf P/N 0030 128.605): 53 °C for 45 min ...
-
bioRxiv - Microbiology 2021Quote: ... Three 6-mm leaf discs from three separate leaves were punched directly into an Eppendorf tube (Eppendorf, Germany) containing 500 μl of CSPL buffer (Omega Bio-Tek ...
-
bioRxiv - Microbiology 2020Quote: ... we pelleted 6 mL of culture for 3 min at 7000 rpm (Benchtop centrifuge 5424 Eppendorf, Hamburg, Germany) inside a glove-box (MBraun ...
-
bioRxiv - Molecular Biology 2024Quote: A total of 350,000 HEK293-T cells were seeded in each well of 6-well plates (#EP0030720113, Eppendorf). Transfection was performed the day after at 40-50% cell confluence ...
-
bioRxiv - Biochemistry 2022Quote: ... Wholemeal flour samples were weighed (6 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf). Phosphate buffered saline (600 μL ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... GEM-RT was performed in a Bio-Rad PTC-200 Thermal Cycler with semi-skirted 96-Well Plate (Eppendorf, P/N 0030 128.605) following ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% P/S on a magnetic separator cells were cultured in fibronectin-coated 6-well plates (Eppendorf, Hamburg, Germany) in DMEM/F-12 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... These reactions were incubated for 0-6 h at 30°C with 500 rpm shaking (Eppendorf, Thermo Mixer C). S ...
-
bioRxiv - Microbiology 2020Quote: ... 0.6 mL culture were centrifuged at 13,350 rpm for 6 min in a Benchtop centrifuge (5424 Eppendorf, Hamburg, Germany). The supernatant was filtered through a 0.22-µm polyvinylidene fluoride syringe filter (Carl Roth ...
-
bioRxiv - Bioengineering 2023Quote: ... these samples were centrifuged for 6 min at 16,740 x g at room temperature (5427 R, Eppendorf, Hamburg, Germany), and the supernatant was discarded ...
-
bioRxiv - Neuroscience 2020Quote: We transferred 5 dpf larvae to 1.5 ml centrifuge tubes (Eppendorf). All fish water was aspirated and replaced with 1.0 ml 4% paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Physiology 2020Quote: ... 1% Antibiotic-Antimycotic] in a 5% CO2 incubator (Galaxy 170R, Eppendorf) at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... volume was reduced to 5 μL in a Speedvac concentrator (Eppendorf) and sequencing libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina) ...
-
bioRxiv - Bioengineering 2021Quote: ... dissected brains were placed in 5 ml tubes (Eppendorf, 0030 119.401) and covered with 4.5 mL of clearing solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 5 min at 37 °C under agitation (Eppendorf, ThermoMixer C). Lobes were pipetted to promote dissociation ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were centrifuged at 272g for 5 minutes (Eppendorf 5810R) at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... and centrifuged at 8000 rpm for 5 min (Centrifuge 5430, Eppendorf), where the dissociated monomers or oligomers were separated and mainly located in the supernatant ...
-
bioRxiv - Biophysics 2023Quote: ... and applied 1,700 V for about 5 ms (Eppendorf Eporator, 4309000027). We quickly washed the cuvette with 500 μl SOC growth medium twice and cells were allowed to recover at 37 °C for 1 hour in a 50 ml conical tube (Corning ...
-
bioRxiv - Plant Biology 2024Quote: ... The seedlings were first placed in 5 mL tubes (Eppendorf #0030119460) and snap frozen in liquid nitrogen.
-
bioRxiv - Cell Biology 2024Quote: Cell culture maintenance incubator (37 °C, 5% CO2, humidified; Eppendorf CellXpert)