Labshake search
Citations for Eppendorf :
701 - 750 of 1115 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and InjectMan®4 micromanipulator (Cat#. 5192000035, Eppendorf) using external continuous pressure ...
-
bioRxiv - Immunology 2021Quote: ... at 10.000 rpm and 4°C (Eppendorf 5804R), for the removal of residual titanium [16].
-
bioRxiv - Cell Biology 2022Quote: ... for 10 minutes at 4°C (Eppendorf, Germany), and supernatants were transferred into fresh tubes to be evaporated to dryness in a CentreVap concentrator at 40°C (Labconco ...
-
bioRxiv - Bioengineering 2024Quote: ... 15 min at 4°C (Eppendorf, Hamburg, Germany). duRNA was generated through equimolar annealing of trRNA/crRNA in duplex buffer (IDT) ...
-
bioRxiv - Microbiology 2024Quote: ... or MasterCycler EP Realplex 4 thermal cycler (Eppendorf). Data were analyzed using recA and gyrA as internal controls ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Molecular Biology 2023Quote: ... One milliliter of the supernatant was then transferred to new tubes after centrifugation at 14,000 rpm (Eppendorf K-5418R). A total of 1.2 mL of a 10 mM sodium periodate solution (Merck ...
-
bioRxiv - Microbiology 2024Quote: ... Injections were performed in less than one-day-old female pupae using a microinjector (Fentojet® Express, Eppendorf®) and a micromanipulator (Narishige®) ...
-
bioRxiv - Neuroscience 2024Quote: ... All small pieces of one big cut were transferred to a 2ml LoBind Protein Eppendorf tube (Eppendorf, Hamburg, Germany) prefilled with lysis buffer (2% SDS ...
-
bioRxiv - Biophysics 2020Quote: ... The cell suspension was subsequently centrifuged for 30 min at 4°C and 3250 × g (Eppendorf Swing-bucket rotor A-4-62). The supernatant was discarded ...
-
bioRxiv - Biochemistry 2022Quote: ... The resin was pelleted down by centrifugation at 4°C (1258 g for 5 min, A-4-81 rotor, Eppendorf, Enfield, CT) and washed with ice-cold 50 mL Binding buffer composed of 10mM imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 10 sec (5424-R Eppendorf microfuge) and the pellet was resuspended with 400 μl TES Solution (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 20°C for 4 hours (Thermomixer 5355 R, Eppendorf). After incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in a Realplex 4 Thermocycler (Eppendorf) using the following program ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C for 20 minutes (Eppendorf® 5418 R) to collect all the cells ...
-
bioRxiv - Genetics 2024Quote: ... 000 RPM for 10 minutes at 4°C (Eppendorf), followed by transfer of the plasma to tubes ...
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Cell Biology 2021Quote: ... Frozen cell pellets were resuspended in hypotonic buffer and homogenized using a disposable plastic pestle (As One Corp., Osaka, Japan) with matched Safe-Lock tubes (Eppendorf). The detailed procedure is summarized in Fig ...
-
bioRxiv - Genomics 2021Quote: ... live cell was index-sorted into one 96-well quadrant of a 384-well plate (Eppendorf lo-bind twin-tec) containing a mixture of DPBS and shearing master mix at a final volume of 2.14 μL using a MoFlo Astrios cell sorter running Summit v6.3 (Beckman Coulter) ...
-
bioRxiv - Genetics 2021Quote: ... Oxford Nanopore Technologies, SQK-LSK109. At this step, the resuspendend beads from the three samples were pooled into one Eppendorf tube ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 nl of the mix was injected into the cell of a one-cell stage embryo using a FemtoJet Microinjector (Eppendorf).
-
bioRxiv - Microbiology 2024Quote: ... A volume of 1 nL containing 500 ng/μL mRNA coding for each of these proteins was injected into one-cell stage embryos using the FemtoJet 4i microinjector (Eppendorf). H2O was used as reference control.
-
bioRxiv - Genomics 2023Quote: ... Single mantamonad cells were then isolated from one of the enriched cultures with an Eppendorf PatchManNP2 micromanipulator using a 65 µm VacuTip microcapillary (Eppendorf) and a Leica Dlll3000 B inverted microscope ...
-
bioRxiv - Genetics 2023Quote: Zebrafish embryos were collected and injected as previously described (Rosen et al., 2009) at one-cell stage using a FemtoJet Injector (Eppendorf) or PV820 injector (WPI ...
-
bioRxiv - Biophysics 2024Quote: ... 50 μM non-acetylated α-Syn was incubated in the absence and presence of 50 μM HtrA1* in 10 mM PBS (pH 7.4) at 37°C 900 rpm for one week in a thermomixer (Thermomixer C, Eppendorf, MA). After one week of fibrilization ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...
-
bioRxiv - Cell Biology 2022Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). The compensation pressure set on the FemtoJet was 35hPa for the whole injection experiment to avoid damages on cells ...
-
bioRxiv - Biophysics 2022Quote: ... The probe was controlled with a micromanipulator (Injectman 4; Eppendorf) and mounted on an inverted epifluorescent microscope.
-
bioRxiv - Molecular Biology 2024Quote: ... followed by high-speed centrifugation (4°C, 12000rpm, Eppendorf, 5424R) for 20 minutes to collect the protein supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... The supernatant was centrifuged (Eppendorf 5810R, A-4-62 Rotor) for 10 minutes at 500 x g to separate the remaining blood cells from the plasma.
-
bioRxiv - Bioengineering 2024Quote: ... Homogenates were agitated at 4°C in a thermomixer (Eppendorf) for 2 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... Microneedles were manually controlled with an InjectMan 4 micromanipulator (Eppendorf). Microinjection of cells were performed on an inverted microscope (Nikon Ti2 Eclipse ...
-
bioRxiv - Cell Biology 2024Quote: ... The probe was controlled with a micromanipulator (Injectman 4, Eppendorf), and mounted on an inverted epifluorescence microscope.
-
bioRxiv - Genetics 2024Quote: ... in a 96-well Eppendorf Realplex 4 PCR machine (Eppendorf).
-
bioRxiv - Cell Biology 2024Quote: ... 4℃ for 15 min using Eppendorf 5810R Centrifuge (Eppendorf, Germany) with A-4-81 Rotor (Eppendorf ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4°C for 10 minutes using a 5415R microcentrifuge (Eppendorf) and supernatants were transferred ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 Ml/well of the product from each 1st PCR plate was pooled into one specific well of the collection plate (Deepwell plate 96/500 μ!, Eppendorf; each well containing all 96 samples from one 1st PCR plate) ...
-
bioRxiv - Plant Biology 2022Quote: ... cheesecloth in four layers were used to filter the mixtures and centrifuged for one hour at 3000 rpm in a centrifuge (5804/5804 R, Eppendorf, Germany). A single layer of Whatman No ...
-
bioRxiv - Genetics 2022Quote: ... solution containing capped mRNAs (green fluorescence protein [GFP]mRNA or mutant pls1 mRNA or wildtype pls1 mRNA) was injected into the zebrafish embryos (one-cell stage) using FemtoJet 4i (Eppendorf, Germany). Embryos at different developmental stages were preserved and collected for subsequent experiments
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... containing 100 ng/μL of Cas9 mRNA and 25 ng/μL of sgRNA was injected into Japanese medaka 39 embryos at the one-cell stage using Femto Jet (Eppendorf, Hamburg, Germany) and GD-1 needles (Narishige ...
-
bioRxiv - Genetics 2020Quote: ... Approximately 3 nl of RNP complex were injected into the animal pole of one-cell stage embryos (50-250 embryos/experiment) using a Femtojet 5247 microinjector (Eppendorf, Hamburg, Germany) under a Nikon DS-Ri2 stereomicroscope ...
-
bioRxiv - Developmental Biology 2022Quote: ... were injected into one of the paired olfactory cavities through fine glass capillaries using a pressurized (Eppendorf FemtoJet Express; Eppendorf, Hamburg, Germany) or hydraulic (IM-6 ...
-
bioRxiv - Genetics 2023Quote: ... we microinjected ∼1 nL microinjection mix into each embryo (either the single cell or one of the dividing cells) using a FemtoJet 4i microinjector (Eppendorf, Hamburg, Germany) (Supplementary Figure S1) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Plant Biology 2021Quote: ... samples were centrifuged (20 min, 15,000g, 4°C, in an Eppendorf 5810R centrifuge ...
-
bioRxiv - Genomics 2021Quote: ... and held at 4 C° using the Mastercycler Nexus (Eppendorf, Australia). This was then cycled a total of 40 times ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and centrifuged at 13 000 rpm/15 minutes/4°C (Eppendorf Centrifuge 5415R ...