Labshake search
Citations for Eppendorf :
551 - 600 of 1598 citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and 10 μL supernatant was aliquoted to a 384-well plate (Eppendorf) using the 384-well module-coupled VPrep liquid handler ...
-
bioRxiv - Molecular Biology 2022Quote: ... the explants were placed in a black 24-well plate (Eppendorf, Germany), on top of 1 mL sterile ...
-
bioRxiv - Systems Biology 2022Quote: ... Single cell or 10 cells were sorted to 96-well plates (Eppendorf) containing 0.5 µL 1% DDM in water by FACS (FACSAria ...
-
bioRxiv - Microbiology 2023Quote: ... assay in an Eppendorf AF2200 plate reader (Eppendorf UK Ltd, United Kingdom). For Illumina sequencing ...
-
Mapping resistance-associated anthelmintic interactions in the model nematode Caenorhabditis elegansbioRxiv - Microbiology 2023Quote: ... Assay-ready plates (ARPs) were prepared using an automatic multichannel pipette (Eppendorf) to add 1 μL of 100X drug stock to each well in 96 well plates ...
-
bioRxiv - Cell Biology 2023Quote: ... Resuspended lipid extracts were diluted 1:10 in 96-well plates (Eppendorf twin tec 96 ...
-
bioRxiv - Microbiology 2023Quote: ... cell samples were diluted in 1-ml 96-well plates (Eppendorf, Germany) and stained with 3 μl of the SG/PI staining solution ...
-
bioRxiv - Microbiology 2023Quote: ... 25µl Matrigel®-organoid suspension was plated in 48 well plates (Eppendorf) and incubated in IntestiCult™ Organoid Growth Medium (STEMCELL Technologies ...
-
bioRxiv - Systems Biology 2024Quote: ... Each deep-well plate was centrifuged at 3220 rcf (Eppendorf Centrifuge 5810R) to pellet the cells ...
-
bioRxiv - Immunology 2023Quote: ... The diluted peptides were transferred to a 384-well plate (951020702, Eppendorf).
-
bioRxiv - Microbiology 2024Quote: ... and 20 µL was transferred to a 384-well PCR plate (Eppendorf) before heating for 10 minutes at 98C ...
-
bioRxiv - Microbiology 2024Quote: ... assay in an Eppendorf AF2200 plate reader (Eppendorf UK Ltd, United Kingdom) and diluted as appropriate.
-
bioRxiv - Immunology 2021Quote: ... Samples were mixed in protein LoBind tubes (Eppendorf, 022431064) and then immediately transferred onto 18-well glass-bottom chamber slides (iBidi ...
-
bioRxiv - Biochemistry 2021Quote: ... were transferred to protein low-bind microcentrifuge tubes (Eppendorf) and washed with 1 mL co-IP wash buffer (50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... Protein concentration was measured using a BioPhotometer D30 (Eppendorf). For storage ...
-
bioRxiv - Plant Biology 2021Quote: ... in protein low binding 1.5 mL tubes (LoBind, Eppendorf) by slowly pipetting against the side of the tube ...
-
bioRxiv - Microbiology 2021Quote: ... Protein concentration was measured using a BioPhotometer D30 (Eppendorf). Additional purification of the Ni-affinity purified NixI and NixIN95A was carried out using a Heparin column ...
-
bioRxiv - Biochemistry 2022Quote: ... Serial dilutions were performed in Protein LoBind tubes (Eppendorf) coated with Bovine Serum Albumin Standard protein (ThermoScientific ...
-
bioRxiv - Biophysics 2022Quote: ... in a protein lo-bind tube (Eppendorf, Hamburg, Germany). Both recombinant proteins were a gift from the Alberti group (Max Planck Institute of Molecular Cell Biology and Genetics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lysates were transferred into 1.5ml protein lobind tubes (Eppendorf), centrifuged at maximum speed for at least 30 minutes at 4°C and supernatants were transferred into new 1.5ml tubes ...
-
bioRxiv - Molecular Biology 2023Quote: ... slurry in 1.5 mL Protein Lo Bind Tubes (Eppendorf). SNAP-tagged LIS1 constructs were first covalently coupled to beads by incubating 50 μL of 1 μM of the respective protein at room temperature for 30 min ...
-
bioRxiv - Biophysics 2023Quote: ... Protein LoBind tubes were purchased from Eppendorf (Hamburg, Germany). µ-Slide 8 well glass bottoms were purchased from Ibidi USA inc ...
-
bioRxiv - Neuroscience 2024Quote: ... Serum was aliquoted into protein LoBind tubes (Eppendorf, Germany) and stored at -80 °C until analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... CSF was collected into protein LoBind tubes (Eppendorf, Germany), immediately put on dry ice and stored at -80 °C until analysis ...
-
bioRxiv - Microbiology 2020Quote: ... (vi) 98°C for 2 min in a thermo-block (Eppendorf, Hamburg, Germany). Sterile DMEM treated in the similar methods served as negative controls ...
-
bioRxiv - Cell Biology 2019Quote: ... and spun at 16,100 × g for 15 min at 4°C (microcentrifuge, Eppendorf). Lysis supernatants were then incubated for 1-h at 4°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... with the addition of mixing the PCR tubes on a Thermomixer C (Eppendorf) every 15 minutes at 200 rpm for 1 min during the RT step ...
-
bioRxiv - Cell Biology 2022Quote: ... at RT for 2X 5min at 2,000 rpm in a ThermoMixer C (Eppendorf). Liquid was removed ...
-
bioRxiv - Microbiology 2021Quote: ... The beads were incubated at 55°C in a Thermomixer (Eppendorf, Hamburg, Germany) at 1,500 rpm for 2 h ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 8.0) during 1 h at 37 °C and 1000 rpm (ThermoMixer, Eppendorf), as described in [12] ...
-
bioRxiv - Cancer Biology 2020Quote: ... Digested peptides were dried at 30°C with vacuum concentrator (Vacufuge Plus, Eppendorf), and subsequently subjected to DIA-MS analysis (see below).
-
bioRxiv - Biochemistry 2021Quote: hPol I samples were centrifuged (4°C; 15,000 rpm; Eppendorf table top centrifuge) for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... and (1×106) incubated at 37°C in centrifuge microtubes (Eppendorf, NY, USA) with or without a M ...
-
bioRxiv - Developmental Biology 2020Quote: ... MeOH was evaporated at 30°C in a vacuum centrifuge (Eppendorf concentrator plus) and 20HE was resuspended in 100 µl EIA buffer and stored at −20°C until usage.
-
bioRxiv - Molecular Biology 2020Quote: ... followed by heating at 70 °C for 20 min on a Thermomixer (Eppendorf). 30 µl of the reduced lysate was loaded per well on 4-20% or 12% ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% bromophenol blue) and incubated at 40 °C in a Thermomixer R (Eppendorf) for 0.5 h ...
-
bioRxiv - Biochemistry 2021Quote: ... Reactions were incubated at 30° C and 500 RPM in a thermomixer (Eppendorf). 20 μl aliquots were removed at each timepoint and heat-inactivated for 20’ at 65° C ...
-
bioRxiv - Microbiology 2021Quote: ... centrifuged at 7000 RPM for 7 min at 4 °C (Eppendorf model 5804R). The supernatant was discarded ...
-
bioRxiv - Immunology 2022Quote: ... The mixture was incubated for 5h at 31°C on a thermoblock (Eppendorf), followed by the removal of 2-MEA by buffer-exchanging to PBS using 100kDa Vivaspin6 columns (Sartorius ...
-
bioRxiv - Synthetic Biology 2023Quote: ... boiled for 10 minutes at 100 °C in a dry block Thermomixer (Eppendorf) and stored at −20 °C until sample processing ...
-
bioRxiv - Genomics 2023Quote: ... pH 1.5) then incubated the tubes at 37°C in a ThermoMixer (Eppendorf) for 90 min with rotation set at 750 rpm ...
-
bioRxiv - Cancer Biology 2024Quote: ... at a 1:50 ratio in a ThermoMixer C (Eppendorf, Nijmegen, The Netherlands) at 2,000 rpm for 18 hours at 37°C.
-
bioRxiv - Cell Biology 2023Quote: ... for 20 min at 37°C at 800 rpm on a Thermomixer (Eppendorf). The experiment was carried out in a biological triplicate ...
-
bioRxiv - Neuroscience 2023Quote: ... for 1 hour under shaking at 400 rpm using a ThermoMixer C (Eppendorf). Luminescent was read at the Cytation5M reader (BioTek) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Bioengineering 2019Quote: ... for 5 minutes at 3,500 RPM (2,465 x g, Eppendorf 5810R v3.3 centrifuge with A-4-62 rotor ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...