Labshake search
Citations for Euromedex :
1 - 50 of 77 citations for P N Nonylphenol Diethoxylate Ring 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... using wet transfer with tris-glycine-methanol buffer (milli-Q H2O supplemented with 15% methanol and 10% 10X Tris-glycine solution, Euromedex). Then ...
-
bioRxiv - Microbiology 2020Quote: ... and selected using 100 μg/mL ampicillin or 50 μg/mL kanamycin sulphate (Euromedex). Agarose Gel purification and DNA plasmid extraction kits were purchased from Macherey-Nagel.
-
bioRxiv - Microbiology 2022Quote: ... and selected using 100 µg/mL ampicillin or/and 34 µg/mL chloramphenicol (Euromedex). Agarose gel purification and DNA plasmid extractions were performed using a QIAquick Gel extraction kit (QIAGEN) ...
-
bioRxiv - Cell Biology 2021Quote: ... and then fixed in a mixture of methanol-free 4% paraformaldehyde (PFA, Euromedex EM-15710) and 0.2% Glutaraldehyde (Euromedex ...
-
bioRxiv - Physiology 2023Quote: ... N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES-KOH pH 7.4 20 mM; EuroMedex, 10-110); Sucrose 110mM ...
-
bioRxiv - Immunology 2022Quote: ... anti-human IgG or anti-human IgA antibodies (Jackson ImmunoReseach, 0.8 µg/ml final) and by adding 100 µl of HRP chromogenic substrate (ABTS solution, Euromedex) after washing steps ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 250 ng of Pd(N)6 random hexamers (Euromedex PM-301L). Real-time qPCR of reversed transcribed RNAs was run with SYBR® Green Master Mix (Biorad ...
-
bioRxiv - Cell Biology 2019Quote: ... The culture medium was supplemented with 80 mM NaCl for the root-growth experiment and with 100 µg/ml kanamycin sulfate (Euromedex) or 25 µg/ml hygromycin B (Duchefa ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Microbiology 2023Quote: ... and 100 mM HEPES (Euromedex) to prevent acidification of the medium ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... before being transferred overnight on a nylon Hybond N+ membrane (Cytiva) in a 20X SSC solution (Euromedex). RNAs were UV crosslinked (120 mJoules ...
-
bioRxiv - Cell Biology 2022Quote: ... BSA (Euromedex, 04-100-812-C), PBS (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... and/or 100 mM HEPES (Euromedex) (this is called THTH ...
-
bioRxiv - Cell Biology 2022Quote: ... + Triton X-100 (2000-C from Euromedex) 0,1% in PBS (20 min at 4°C) ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% Triton X-100 (Euromedex, 2000-A), 1.5 mM MgCl2 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed three times using PBS-T (PBS 1X + 0,1% Triton X-100 + 0,02% Sodium Azide) and incubated with PBS-T + BSA (04-100-812-C from Euromedex) 1% for 30 min at RT ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit polyclonal anti-Hec1pS55 (Euromedex, GTX70017, 1:100), rabbit polyclonal anti-Mad2 (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.1% BSA (04-100-812-C, Euromedex) to block nonspecific binding ...
-
bioRxiv - Developmental Biology 2023Quote: ... and permeabilized with 0.01% Triton X-100 (Euromedex, T8787) in PBS (PBT ...
-
bioRxiv - Biochemistry 2021Quote: ... RNase A (20 μg/ml, Euromedex) and 2 M NaCl for 1.5 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... and 10 mg/mL rapamycin (Euromedex) were prepared in dimethylsulfoxide (DMSO ...
-
bioRxiv - Developmental Biology 2022Quote: ... washed in PBS and permeabilized in 0.01% Triton X-100 (Euromedex, T8787) in PBS (PBT ...
-
bioRxiv - Developmental Biology 2019Quote: ... washed in PBS and permeabilized in 0.01% Triton X-100 (Euromedex, T8787) in PBS (PBT ...
-
bioRxiv - Developmental Biology 2022Quote: ... washed in PBS and permeabilized in 0.01% Triton X-100 (Euromedex, T8787) in PBS (PBT ...
-
bioRxiv - Developmental Biology 2023Quote: ... washed in PBS and permeabilized in 0.01% Triton X-100 (Euromedex, T8787) in PBS (PBT ...
-
bioRxiv - Biochemistry 2023Quote: ... and 0.1mg/ml Phenylmethylsulfonyl fluoride (PMSF; Euromedex). Lysed cells were centrifuged for (38,400g ...
-
bioRxiv - Immunology 2019Quote: ... a blocking step with 100 μl of 3% bovine serum albumin (BSA) (Euromedex) in PBS was performed for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... 100 mM NaCl and 1% CHAPS (3-[(3-cholamidopropyl) diméthylammonio]-1-propanesulfonate (Euromedex). The supernatant was cleared by centrifugation at 53 000 g for 30 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then washed in PBS + 0.1% Triton X-100 (Euromedex 2000-C) (PBT) ...
-
bioRxiv - Molecular Biology 2019Quote: ... De-proteinated plugs were washed with 10 ml TE followed by washing with 10 ml TE + 1 mM AEBSF (Euromedex) for 2 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... spheroids were permeabilized for 5 min using Triton X-100 (2000-C from Euromedex) 0,3% in PBS and blocked for 30min using Blocking Buffer (BB= PBS 1X + 0,3% Triton X-100 + 0,02% Sodium Azide + 3% BSA) ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were revealed by adding 100 μl of HRP chromogenic substrate (ABTS solution, Euromedex) after PBST washings ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were revealed by adding 100 μl of HRP chromogenic substrate (ABTS solution, Euromedex) after PBST washes ...
-
bioRxiv - Cell Biology 2022Quote: ... and DNase I (0.1 mg/mL) (1307, Euromedex) in PBS for 10 min at 37°C under agitation ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 50 µg/mL proteinase K (Euromedex EU0090-A). The reaction was stopped by adding 2 µL phenylmethanesulfonyl fluoride solution at 200 µM for 10 min on ice.
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... organoids were washed with PBS and permeabilised in PBS + 1% triton X-100 (Euromedex 2000-C) for 1h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: Stock solutions of 10 mg/mL caspofungin (Euromedex, Souffelweyersheim, France) and 10 mg/mL rapamycin (Euromedex ...
-
bioRxiv - Genomics 2023Quote: ... 50 mL of culture was fixed in 1% formaldehyde (Euromedex), quenched with glycine ...
-
bioRxiv - Cell Biology 2022Quote: ... washed again in 1X PBS and blocked for 1h in 5% BSA (Euromedex, 04-100-812-C) in 1X PBS at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... 5% glycerol) supplemented with 0.25 mg/mL lysozyme (5934-D, Euromedex), 1 mM phenylmethylsulfonyl fluoride (Sigma) ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were next cultured with 2.5 µg/ml of puromycin (Euromedex) for the selection of cells transfected with the ORF1-V5-puro replicon.
-
bioRxiv - Biochemistry 2023Quote: ... 1μM ACKR3 agonist VUF11207 and protease inhibitors: 50μg/ml Leupeptin (Euromedex), 0.1mg/ml Bensamidine (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... and then rocked overnight at 4°C in TBST 5% BSA (Fraction V, 04-100-812-C, Euromedex) with primary antibodies ...
-
bioRxiv - Developmental Biology 2020Quote: ... Samples were denatured by boiling in loading buffer (4× 100 mM Tris-HCL, pH 6.8, 8% SDS (Cat#EU0660, Euromedex), 40% glycerol (Cat#G9012 ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.1% Triton X-100 and 0.02% SDS (Euromedex, EU0660) in PBS for 5 min ...
-
bioRxiv - Biophysics 2021Quote: ... 5 mM β-mercaptoethanol and complemented with 0.025 mg/ml RNAse (Euromedex), 0.025 mg/ml DNAse (Sigma Aldrich ...
-
bioRxiv - Physiology 2020Quote: ... Genomic DNA was extracted using Proteinase K (20 mg/mL; Euromedex, France) and 1 mM of Tris-EDTA Buffer (pH = 8) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Genomic DNA was extracted using Proteinase K (20 mg/mL; Euromedex, France) and 1 mM of Tris-EDTA Buffer (pH = 8) ...
-
bioRxiv - Microbiology 2023Quote: ... growth media were supplemented with chloramphenicol (Cm 25 μg/mL; EUROMEDEX, China). The strain Lactococcus lactis ssp ...