Labshake search
Citations for Euromedex :
1 - 50 of 58 citations for Herpes Simplex Virus 1 Lysate Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates were incubated for 4 h at 4°C with an anti-Flag antibody coupled to agarose beads (Euromedex). The beads were then washed 3 times with lysis buffer and 1 time with PBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 g.L−1 5-FOA (Euromedex) or 0.06 g.L−1 canavanine (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... 1% BSA (Euromedex), 1mM EDTA (GIBCO) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1:200 (Euromedex), TFE3 ...
-
bioRxiv - Systems Biology 2023Quote: ... The strains were grown in liquid SC medium (Yeast Nitrogen Base with ammonium sulfate 6.7 g.l−1, MPbio, OH, USA; amino acid mixture 2 g.l−1, MPbio; glucose 20 g.l−1, Euromedex, France). The culture was maintained until the strains reached their growth mid log phase using an optical plate reader (Tecan infinite F200 pro) ...
-
bioRxiv - Microbiology 2020Quote: ... 100 mM NaCl and 1% CHAPS (3-[(3-cholamidopropyl) diméthylammonio]-1-propanesulfonate (Euromedex). The supernatant was cleared by centrifugation at 53 000 g for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% deoxycholate Na, 0.1% SDS, 1 mM AEBSF [Euromedex] and cOmplete EDTA-free [Roche]) with glass beads (diameter ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20 g.L−1 agar (Euromedex), 10 g.L−1 peptone (Euromedex ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 g.L−1 peptone (Euromedex) and 10 g.L−1 yeast extraction (Euromedex) ...
-
bioRxiv - Cell Biology 2020Quote: ... and saturated with PBS BSA 1% (Euromedex) for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (1:1000; 2A3, Euromedex) rabbit anti-Calnexin (1:1000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 g.L−1 yeast extraction (Euromedex). The 5-FOA and CAN plates contained 20 g.L−1 glucose ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.79 g.L−1 complete supplement mixture (Euromedex) and 1 g.L−1 5-FOA (Euromedex ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% Triton X-100 (Euromedex, 2000-A), 1.5 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.1% Tween-20) containing 4% dehydrated half-creamed milk, and incubated (overnight, 4°C) rabbit anti-MFGE8 (1/1000, Euromedex), then with anti-mouse horseradish peroxidase-conjugated antibodies (1/3000 ...
-
bioRxiv - Immunology 2021Quote: ... Cells were cross-linked with 1% formaldehyde (Euromedex) for 8 minutes at room temperature and the reaction quenched in 150mM glycine for 10 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... rifampicin (60 μg.mL−1, EUROMEDEX, 1059, Souffelweyersheim, France), penicillin (50 units.mL−1 ...
-
bioRxiv - Physiology 2021Quote: ... and DAPI (1 μg/μL, 10-50A, Euromedex), sections were washed ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit polyclonal anti-Hec1pS55 (Euromedex, GTX70017, 1:100), rabbit polyclonal anti-Mad2 (1:100 ...
-
bioRxiv - Microbiology 2019Quote: ... Yeasts were washed once in SPM buffer and incubated for 1 h at 30°C in 1 mL of a solution containing 2 mg of Zymolyase 20T (Euromedex®), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... Organoids were then washed with PBS for 3 times for 5 min each and stored in 1:1 ratio PBS and glycerol (Euromedex 15710) before imaging ...
-
bioRxiv - Immunology 2023Quote: ... and purified Tregs at a ratio 1:1 in 96-well plates pre-coated with gelatin-based coating solution (from Cell Biologics, Euromedex).
-
bioRxiv - Molecular Biology 2020Quote: ... and the appropriate selection antibiotics (Euromedex, Supplementary Table 1). For seeding NIH/3T3 cells on coverslips ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-actin (1:5000; ACT-2D7, Euromedex).
-
bioRxiv - Microbiology 2020Quote: ... 1mM of isopropyl ß-D-1-thiogalactopyranoside (IPTG, EuroMedex) was added to agarose pads or culture media.
-
bioRxiv - Immunology 2020Quote: ... polyclonal rabbit anti-calnexin antibody (1:1000; Euromedex, Souffelweyersheim, France), β–actin (W16197A ...
-
bioRxiv - Cell Biology 2020Quote: ... Freshly-made solution of 20% acrylamide 37.5/1 bisacrylamide (Euromedex) in MiliQ water ...
-
bioRxiv - Cell Biology 2021Quote: ... mESC cells were crosslinked in 1% formaldehyde (Euromedex, #EM-15686) for 15 min at room temperature and quenched with 0,12 M glycine provided in the kit ...
-
bioRxiv - Genomics 2023Quote: ... 50 mL of culture was fixed in 1% formaldehyde (Euromedex), quenched with glycine ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were labelled with 1 µM DAPI (Euromedex, 1050-A) alone ...
-
bioRxiv - Cell Biology 2020Quote: ... the imaging media was supplemented with 10µM 1-NA-PP1 (Euromedex). However ...
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-α-tubulin (1:5000, GT114, Cat. #GTX628802, Euromedex). Alexa Fluor conjugated secondary antibodies used ...
-
bioRxiv - Cell Biology 2023Quote: ... A freshly prepared solution containing 20% 37.5/1 acrylamide/bisacrylamide (Euromedex), in MilliQ water ...
-
bioRxiv - Biophysics 2022Quote: ... TB:PBS is obtained by mixing TB (Tryptone broth, Euromedex, 10 g.L−1) and PBS (w/o calcium and magnesium ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1.71 g.L−1 yeast nitrogen base without amino acids and nitrogen (Euromedex) and 5 g.L−1 ammonium sulfate (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1 mg/ml X-Gal (ref EU0012-D, Euromedex, Souffelweyersheim, France) previously resuspended in N-N’ dimethylformamide ...
-
bioRxiv - Developmental Biology 2021Quote: ... washed 1×5 min in 2xSSCT (2X Saline Sodium Citrate (Euromedex #EU0300-A) 0,1% Tween-20 (Sigma Aldrich #P1379 ...
-
bioRxiv - Plant Biology 2019Quote: ... The medium contained 10 g L−1 of purified agar (Euromedex, https://web.euromedex.com/) and 0.5 mM MgSO4 ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 1×5 min in 2xSSCT (2X Saline Sodium Citrate (Euromedex #EU0300-A) 0,1% Tween-20 (Sigma Aldrich #P1379 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Expression of PolDExo- was induced with 1 mM final IPTG (0008-B Euromedex) and growth was continued overnight at 20°C ...
-
bioRxiv - Plant Biology 2022Quote: ... adults were placed on detached Chinese cabbage leaves that were laid on 1 % agarose (Euromedex) in a Petri dish ...
-
bioRxiv - Microbiology 2022Quote: ... THP-1 cells media was also supplemented with 0.05 mM β-mercaptoethanol (Euromedex, cat. 4227-A) and 10 mM HEPES (Sigma ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... organoids were washed with PBS and permeabilised in PBS + 1% triton X-100 (Euromedex 2000-C) for 1h at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Induction was done at 37°C by adding isopropyl-1-thio-β-D-galactopyranoside (IPTG, Euromedex) to a final concentration of 500 mM ...
-
A quantitative tri-fluorescent yeast two-hybrid system: from flow cytometry to in-cellula affinitiesbioRxiv - Biochemistry 2019Quote: ... 1/2000 in PBS + tween 0.2% (v/v) + 10 mg/ml BSA (Albumin bovine fraction V, Euromedex). The membrane was then washed four times seven minutes in blocking buffer at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed three times using PBS-T (PBS 1X + 0,1% Triton X-100 + 0,02% Sodium Azide) and incubated with PBS-T + BSA (04-100-812-C from Euromedex) 1% for 30 min at RT ...
-
bioRxiv - Developmental Biology 2020Quote: Vibratome sections were permeabilized and blocked with PBTA2 solution (2% BSA, 2% FBS, 1% Tween20 (Cat#2001-A, Euromedex) for 2h at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... the coverslips were incubated with a secondary antibody (anti-rabbit antibodies conjugated with Alexa fluorophores diluted 1:500) for 45 min in blocking solution supplemented with ribonuclease inhibitor (0.8 μl/ml; Euromedex). Coverslips were then washed three times with PBS for 5 min at RT ...
-
bioRxiv - Molecular Biology 2019Quote: ... De-proteinated plugs were washed with 10 ml TE followed by washing with 10 ml TE + 1 mM AEBSF (Euromedex) for 2 hours ...