Labshake search
Citations for Euromedex :
1 - 50 of 88 citations for 7H Purine 7 acetamide N dibenzofuran 3 yl 1 2 3 6 tetrahydro 1 3 dimethyl 2 6 dioxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 100 mM NaCl and 1% CHAPS (3-[(3-cholamidopropyl) diméthylammonio]-1-propanesulfonate (Euromedex). The supernatant was cleared by centrifugation at 53 000 g for 30 min ...
-
bioRxiv - Microbiology 2023Quote: ... and 3% BSA (Euromedex). A horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Abcam ...
-
bioRxiv - Immunology 2023Quote: ... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
bioRxiv - Physiology 2023Quote: ... N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES-KOH pH 7.4 20 mM; EuroMedex, 10-110); Sucrose 110mM ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 250 ng of Pd(N)6 random hexamers (Euromedex PM-301L). Real-time qPCR of reversed transcribed RNAs was run with SYBR® Green Master Mix (Biorad ...
-
bioRxiv - Microbiology 2023Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... Organoids were then washed with PBS for 3 times for 5 min each and stored in 1:1 ratio PBS and glycerol (Euromedex 15710) before imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... Mice received 3 mg of tamoxifen free base (Euromedex) by intraperitoneal injection two days prior to intravital imaging.
-
Kinetochore individualization in meiosis I is required for centromeric cohesin removal in meiosis IIbioRxiv - Cell Biology 2020Quote: ... For whole-mount staining of stable spindle microtubules oocytes were incubated 2-6 min in a cold treatment solution (80mM PIPES (Euromedex, 1124), 1mM MgCl2 (Euromedex ...
-
bioRxiv - Cell Biology 2020Quote: ... wells were washed twice with 3% bovine serum albumin (Euromedex, Souffelweyersheim, France) in PBS ...
-
bioRxiv - Immunology 2019Quote: ... a blocking step with 100 μl of 3% bovine serum albumin (BSA) (Euromedex) in PBS was performed for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 6 % agarose (LE-8200-B, Euromedex) PBS solution ...
-
bioRxiv - Systems Biology 2023Quote: ... The strains were grown in liquid SC medium (Yeast Nitrogen Base with ammonium sulfate 6.7 g.l−1, MPbio, OH, USA; amino acid mixture 2 g.l−1, MPbio; glucose 20 g.l−1, Euromedex, France). The culture was maintained until the strains reached their growth mid log phase using an optical plate reader (Tecan infinite F200 pro) ...
-
bioRxiv - Developmental Biology 2020Quote: Vibratome sections were permeabilized and blocked with PBTA2 solution (2% BSA, 2% FBS, 1% Tween20 (Cat#2001-A, Euromedex) for 2h at room temperature ...
-
bioRxiv - Genetics 2021Quote: ... 6 μL of Proteinase K (Euromedex, EU0090-C) were added and after 1 hour at 50°C ...
-
Negative curvature-promoting lipids instruct nuclear ingression of low autophagic potential vacuolesbioRxiv - Cell Biology 2021Quote: ... 6 μL of Proteinase K (Euromedex, EU0090-C) were added for 1 hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 6 µL of Proteinase K (Euromedex, EU0090-C) were added for 1 hour at 50°C ...
-
bioRxiv - Microbiology 2019Quote: ... Yeasts were washed once in SPM buffer and incubated for 1 h at 30°C in 1 mL of a solution containing 2 mg of Zymolyase 20T (Euromedex®), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.1% Triton X-100 and 0.02% SDS (Euromedex, EU0660) in PBS for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... Yeast cells were transformed using the yeast transformation procedure described in [14] and selected on YNB Acetamide plates (1.7 g/L yeast nitrogen base without amino acids and nitrogen (Euromedex), 6.6 g/L K2SO4 ...
-
bioRxiv - Microbiology 2020Quote: ... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated in an appropriate buffer solution at pH6 containing bromo-4-chloro-3-indolyl-β-D-galactopyranoside (Euromedex, Souffelweyersheim, France), as described previously (Gorwood ...
-
bioRxiv - Microbiology 2023Quote: ... and 2% agarose D3 (Euromedex, France ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL microtubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos were fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: Embryos are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... the samples were fixed with 2 % paraformaldehyde (PFA, EMS, Euromedex) in phosphate-buffered saline (PBS ...
-
bioRxiv - Developmental Biology 2023Quote: Embryos or doublets are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 g.L−1 5-FOA (Euromedex) or 0.06 g.L−1 canavanine (Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: Embryos in the inverse bleb phase were fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... Agarose soluble extract media (ASEM) was prepared by adding 2 g of Agarose D3 (Euromedex) to a 5 g/L solution of Tryptone media (Bacto™) ...
-
bioRxiv - Microbiology 2020Quote: ... 1% BSA (Euromedex), 1mM EDTA (GIBCO) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1:200 (Euromedex), TFE3 ...
-
bioRxiv - Genomics 2023Quote: ... at 37 °C for 2 hours and with 8 μL of proteinase K (Euromedex, 09-0911) at 56 °C for 2 hours to complete the lysis ...
-
bioRxiv - Microbiology 2023Quote: ... mice received an IP injection of 2 mg of MAR1-5A3 anti-IFNAR antibody (Euromedex, Cat#BX-BE0241) one day prior infection ...
-
bioRxiv - Molecular Biology 2019Quote: ... 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% deoxycholate Na, 0.1% SDS, 1 mM AEBSF [Euromedex] and cOmplete EDTA-free [Roche]) with glass beads (diameter ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20 g.L−1 agar (Euromedex), 10 g.L−1 peptone (Euromedex ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 g.L−1 peptone (Euromedex) and 10 g.L−1 yeast extraction (Euromedex) ...
-
bioRxiv - Immunology 2023Quote: ... The muMECs were seeded in T75 tissue culture flasks pre-coated with gelatin-based coating solution for 2 min (from Cell Biologics, Euromedex) and cultures were divided twice a week or as necessary ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... and saturated with PBS BSA 1% (Euromedex) for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (1:1000; 2A3, Euromedex) rabbit anti-Calnexin (1:1000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 g.L−1 yeast extraction (Euromedex). The 5-FOA and CAN plates contained 20 g.L−1 glucose ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.79 g.L−1 complete supplement mixture (Euromedex) and 1 g.L−1 5-FOA (Euromedex ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% Triton X-100 (Euromedex, 2000-A), 1.5 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.1% Tween-20) containing 4% dehydrated half-creamed milk, and incubated (overnight, 4°C) rabbit anti-MFGE8 (1/1000, Euromedex), then with anti-mouse horseradish peroxidase-conjugated antibodies (1/3000 ...