Labshake search
Citations for Euromedex :
1 - 50 of 119 citations for 7 CHLORO N N DIETHYL 4 NITRO 2 1 3 BENZOXADIAZOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... N-(2-Hydroxyethyl)piperazine-N′-(2-ethanesulfonic acid) (HEPES-KOH pH 7.4 20 mM; EuroMedex, 10-110); Sucrose 110mM ...
-
bioRxiv - Microbiology 2020Quote: ... 1μL was then spotted on LB media supplemented with 40 μg/mL of 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal) (Euromedex), ampicillin (Amp ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated in an appropriate buffer solution at pH6 containing bromo-4-chloro-3-indolyl-β-D-galactopyranoside (Euromedex, Souffelweyersheim, France), as described previously (Gorwood ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 250 ng of Pd(N)6 random hexamers (Euromedex PM-301L). Real-time qPCR of reversed transcribed RNAs was run with SYBR® Green Master Mix (Biorad ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... before being transferred overnight on a nylon Hybond N+ membrane (Cytiva) in a 20X SSC solution (Euromedex). RNAs were UV crosslinked (120 mJoules ...
-
bioRxiv - Immunology 2023Quote: ... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... Organoids were then washed with PBS for 3 times for 5 min each and stored in 1:1 ratio PBS and glycerol (Euromedex 15710) before imaging ...
-
bioRxiv - Microbiology 2020Quote: ... 100 mM NaCl and 1% CHAPS (3-[(3-cholamidopropyl) diméthylammonio]-1-propanesulfonate (Euromedex). The supernatant was cleared by centrifugation at 53 000 g for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 g.L−1 5-FOA (Euromedex) or 0.06 g.L−1 canavanine (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL micro tubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL microtubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.1% Tween-20) containing 4% dehydrated half-creamed milk, and incubated (overnight, 4°C) rabbit anti-MFGE8 (1/1000, Euromedex), then with anti-mouse horseradish peroxidase-conjugated antibodies (1/3000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were incubated with primary antibodies at 4°C overnight in TBST 0.05% with 5% BSA (Euromedex), washed 3x 10 min with TBST 0.05% ...
-
bioRxiv - Microbiology 2023Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Blue-fluorescent DNA stain 4’,6-diamidino-2-phenylindole (DAPI) was purchased from Euromedex (Souffelweyersheim, France). Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... washed 3 times for 5 min in PBS and permeabilized with 0.1% Triton X-100 and 0.02% SDS (Euromedex, EU0660) in PBS for 5 min ...
-
bioRxiv - Immunology 2021Quote: ... and then rocked overnight at 4°C in TBST 5% BSA (Fraction V, 04-100-812-C, Euromedex) with primary antibodies ...
-
bioRxiv - Systems Biology 2023Quote: ... The strains were grown in liquid SC medium (Yeast Nitrogen Base with ammonium sulfate 6.7 g.l−1, MPbio, OH, USA; amino acid mixture 2 g.l−1, MPbio; glucose 20 g.l−1, Euromedex, France). The culture was maintained until the strains reached their growth mid log phase using an optical plate reader (Tecan infinite F200 pro) ...
-
bioRxiv - Developmental Biology 2020Quote: Vibratome sections were permeabilized and blocked with PBTA2 solution (2% BSA, 2% FBS, 1% Tween20 (Cat#2001-A, Euromedex) for 2h at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... washed 1×5 min in 2xSSCT (2X Saline Sodium Citrate (Euromedex #EU0300-A) 0,1% Tween-20 (Sigma Aldrich #P1379 ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 1×5 min in 2xSSCT (2X Saline Sodium Citrate (Euromedex #EU0300-A) 0,1% Tween-20 (Sigma Aldrich #P1379 ...
-
bioRxiv - Microbiology 2023Quote: ... and 3% BSA (Euromedex). A horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Abcam ...
-
bioRxiv - Developmental Biology 2020Quote: ... cells were fixed 15 min at 4°C with PFA 4% (15710, Euromedex) after 7 days of culture ...
-
bioRxiv - Microbiology 2019Quote: ... Yeasts were washed once in SPM buffer and incubated for 1 h at 30°C in 1 mL of a solution containing 2 mg of Zymolyase 20T (Euromedex®), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
bioRxiv - Biochemistry 2023Quote: 5-FOA (EUROMEDEX, 1555) resistant colonies were grown on uracil-containing liquid media overnight and 10 µL of 5 fold serial dilutions (from 1.107 cells/mL to 1.105 cells/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-FOA (EUROMEDEX, 1555) resistant colonies were grown on plates containing uracil with or without thiamine for 2 days at 30 °C and subsequently inoculated into EMMg supplemented with uracil for 24 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were probed with the following antibodies overnight at 4°C under stirring: anti-hDICER (1:1000, A301-937A, Euromedex, Bethyl), anti-PKR (1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: Cells were fixed in 4% paraformaldehyde (Euromedex), stained using standard immunocytochemical procedures and mounted in ProLong Gold Antifade reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... fixed with 4% paraformaldehyde (Euromedex, cat. 15713), quenched with 50 mM NH4Cl (Sigma cat ...
-
bioRxiv - Cell Biology 2021Quote: ... fixed with 4% paraformaldehyde (Euromedex, cat. 15713) for 10 min ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... After fixation using 4% Paraformaldehyde (Euromedex 15710) in PBS for 1h at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were blocked with 5% BSA-TBST (5% BSA Sigma, TBS 1x Euromedex, 0,1% Tween20 Sigma) for 30 min and incubated with primary antibodies (diluted in 5% BSA-TBST ...
-
bioRxiv - Cell Biology 2021Quote: ... Mice received 3 mg of tamoxifen free base (Euromedex) by intraperitoneal injection two days prior to intravital imaging.
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates were incubated for 4 h at 4°C with an anti-Flag antibody coupled to agarose beads (Euromedex). The beads were then washed 3 times with lysis buffer and 1 time with PBS ...
-
bioRxiv - Microbiology 2023Quote: ... and 2% agarose D3 (Euromedex, France ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were washed in 5% BSA (Euromedex)-containing PBS ...
-
bioRxiv - Physiology 2020Quote: ... Samples were fixed 24 hours in 4% PFA (15714, Euromedex) and decalcified in 19% EDTA (EU00084 ...
-
bioRxiv - Neuroscience 2022Quote: Fixation was performed in 4% paraformaldehyde (PFA, EMS Euromedex, #15710) for 20 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... wells were washed twice with 3% bovine serum albumin (Euromedex, Souffelweyersheim, France) in PBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... Milk was replaced with 5% BSA (Cat#04100811C, Euromedex) for detection of phosphorylated epitopes.
-
bioRxiv - Immunology 2019Quote: ... a blocking step with 100 μl of 3% bovine serum albumin (BSA) (Euromedex) in PBS was performed for 30 min at 37°C ...
-
bioRxiv - Genetics 2023Quote: ... slides were placed in PBS/0.1% Triton/5% BSA (Euromedex) for 90 min at RT ...
-
bioRxiv - Physiology 2022Quote: ... Non-specific binding was blocked with 4% bovine serum albumin (BSA, Euromedex) diluted in 1X PBS supplemented with Tween 0.1% ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos were fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: Embryos are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...