Labshake search
Citations for Euromedex :
201 - 250 of 412 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... tissues were homogenized in TRI Reagent (TR118, Euromedex) at a ratio of 100 mg per mL of TRI Reagent ...
-
bioRxiv - Immunology 2023Quote: ... composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics, Euromedex) containing fetal bovine serum ...
-
bioRxiv - Immunology 2023Quote: ... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
bioRxiv - Immunology 2023Quote: C57BL/6 mouse primary uterine microvascular endothelial cells or muMECs were from Cell Biologics (distributed by Euromedex, Souffelweyersheim, France). These cells were cultured at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... and purified Tregs at a ratio 1:1 in 96-well plates pre-coated with gelatin-based coating solution (from Cell Biologics, Euromedex).
-
bioRxiv - Neuroscience 2023Quote: ... and 0.1% BSA (04-100-812-C, Euromedex) to block nonspecific binding ...
-
bioRxiv - Neuroscience 2023Quote: ... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
bioRxiv - Neuroscience 2023Quote: ... 100µL of PBS 10X (Euromedex) and 367.5µL of Neurobasal-A ...
-
bioRxiv - Genomics 2023Quote: Total RNA was extracted from 14- or 16-day-old seedlings with RNAzol (Euromedex) and then treated with the RQ1 RNase-free DNase (Promega ...
-
bioRxiv - Genetics 2023Quote: ... slides were placed in PBS/0.1% Triton/5% BSA (Euromedex) for 90 min at RT ...
-
bioRxiv - Genetics 2023Quote: ... cells were treated with 200 µg of RNase A (Euromedex, cat.9707-C) at 37°C overnight ...
-
bioRxiv - Microbiology 2023Quote: ... and 3% BSA (Euromedex). A horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Abcam ...
-
bioRxiv - Genomics 2023Quote: ... the slides were immersed in 5X SSC solution overnight (O/N) at RT (Euromedex, EU0300-C). The following day ...
-
bioRxiv - Microbiology 2023Quote: ... or pUT18C (Euromedex). The ligated plasmids were transformed into E ...
-
bioRxiv - Microbiology 2023Quote: ... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cisplatin was obtained from Selleckchem (Euromedex, Souffelweyersheim, France) and resuspended in DMSO ...
-
bioRxiv - Molecular Biology 2023Quote: ... plugs and incubated overnight at 55 °C in a digestion buffer with 1 mg/mL of proteinase K (Euromedex EU0090). Then plugs were washed with TE buffer (50 mM Tris ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture (2.5 µL) was deposited on the surface of 1 mL of tryptone-NaCl medium solidified with 2% agarose D3 (Euromedex) poured in 2 mL microtubes or in wells of 24-well plates and incubated overnight at 37°C ...
-
bioRxiv - Developmental Biology 2023Quote: Embryos or doublets are fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were incubated with primary antibodies at 4°C overnight in TBST 0.05% with 5% BSA (Euromedex), washed 3x 10 min with TBST 0.05% ...
-
bioRxiv - Microbiology 2023Quote: ... mice received an IP injection of 2 mg of MAR1-5A3 anti-IFNAR antibody (Euromedex, Cat#BX-BE0241) one day prior infection ...
-
bioRxiv - Bioengineering 2023Quote: ... Minimal YNB medium contained 1.7 g/L yeast nitrogen base without amino acids and nitrogen (Euromedex) and 5 g/L ammonium sulphate ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5-FOA (EUROMEDEX, 1555) resistant colonies were grown on plates containing uracil with or without thiamine for 2 days at 30 °C and subsequently inoculated into EMMg supplemented with uracil for 24 h ...
-
bioRxiv - Microbiology 2023Quote: ... 0.003% of SDS (Euromedex) or 0.2 mM of diamide (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... and 10 mg/mL rapamycin (Euromedex) were prepared in dimethylsulfoxide (DMSO ...
-
bioRxiv - Microbiology 2023Quote: Stock solutions of 10 mg/mL caspofungin (Euromedex, Souffelweyersheim, France) and 10 mg/mL rapamycin (Euromedex ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 mM KCl) were incubated on ice with 50 mM DTT (Euromedex, EU0006), final concentration ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were washed three times using PBS-T (PBS 1X + 0,1% Triton X-100 + 0,02% Sodium Azide) and incubated with PBS-T + BSA (04-100-812-C from Euromedex) 1% for 30 min at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... + Triton X-100 (2000-C from Euromedex) 0,1% in PBS (20 min at 4°C) ...
-
bioRxiv - Cell Biology 2022Quote: ... spheroids were permeabilized for 5 min using Triton X-100 (2000-C from Euromedex) 0,3% in PBS and blocked for 30min using Blocking Buffer (BB= PBS 1X + 0,3% Triton X-100 + 0,02% Sodium Azide + 3% BSA) ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmids verified by sequencing before BACTH assays (76) were set up according to the manufacturer (Euromedex). Co-transformation of plasmids containing fusion-genes of opposite domains ...
-
bioRxiv - Immunology 2022Quote: Sorted cells were lysed in 40 μl Viagen Direct PCR Lysis Reagent (cell) (Euromedex) supplemented with 0,5 mg/ml Proteinase K Solution RNA grade (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-actin (1:5000; ACT-2D7, Euromedex).
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (1:1000; 2A3, Euromedex) rabbit anti-Calnexin (1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... washed in PBS and permeabilized in 0.01% Triton X-100 (Euromedex, T8787) in PBS (PBT ...
-
bioRxiv - Developmental Biology 2022Quote: Embryos were fixed in 2% PFA (Euromedex, 2000-C) for 10 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... IPTG (EU0008-C) and lysozyme (5933) from Euromedex. Imidazole from Fisher Scientific (Fisher Chemical I/0010/53) ...
-
bioRxiv - Microbiology 2022Quote: ... and selected using 100 µg/mL ampicillin or/and 34 µg/mL chloramphenicol (Euromedex). Agarose gel purification and DNA plasmid extractions were performed using a QIAquick Gel extraction kit (QIAGEN) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Imatinib mesylate (STI571) (10 mM stock solution, Euromedex, France) was used to block KIT and ICC activity (Beckett et al. ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA was extracted using Trizol reagent (Euromedex, France) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Formaldehyde 16% in aqueous solution (Euromedex, 15710), BSA (Euromedex ...
-
bioRxiv - Cell Biology 2022Quote: ... BSA (Euromedex, 04-100-812-C), PBS (Gibco ...
-
bioRxiv - Physiology 2022Quote: ... Non-specific binding was blocked with 4% bovine serum albumin (BSA, Euromedex) diluted in 1X PBS supplemented with Tween 0.1% ...
-
bioRxiv - Microbiology 2022Quote: ... pUT18 or pUT18C (Euromedex). E ...
-
bioRxiv - Bioengineering 2022Quote: ... rifampicin (60 μg.mL−1, EUROMEDEX, 1059, Souffelweyersheim, France), penicillin (50 units.mL−1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli BTH101 (Euromedex) was used for BACTH assays ...
-
bioRxiv - Cell Biology 2022Quote: ... installed in Mini-PROTEAN® tetra vertical electrophoresis cell filled with 1X TG-SDS solution (Euromedex). The gels were run for 1 h at constant 150 volts ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1X equivalent of mammalian protease inhibitor (100X stock solution Euromedex, #B14011), or 1X equivalent of bacterial protease inhibitor (10X stock solution Sigma-Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... THP-1 cells media was also supplemented with 0.05 mM β-mercaptoethanol (Euromedex, cat. 4227-A) and 10 mM HEPES (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... Equal amounts of GST or GST-Trim69 proteins were then bound to 10 μg of pure porcine brain tubulin (purchased from Euromedex, cat. CS-T240-A) in a total volume of 40 μl of PEM buffer supplemented with 40 μM of Taxol and 1mM GTP ...