Labshake search
Citations for Omega Bio-Tek :
1 - 50 of 574 citations for rno mir 22 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were purified using E.Z.N.A® PCR Cycle Pure kit (OMEGA bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Cycle Pure PCR Clean-Up Kit (Omega Bio-Tek). The purified library was sequenced on the Illumina MiSeq platform (v2 chemistry ...
-
bioRxiv - Genomics 2020Quote: ... Amplified PCR products were cleaned using magnetic beads (Mag-Bind PCR Clean-up Kit, Omega Bio-tek Inc.
-
bioRxiv - Genetics 2023Quote: ... These DNA templates were individually PCR-amplified and purified using a PCR clean-up kit (Omega Bio-tek D6492). In the FOXA1 EMSAs ...
-
bioRxiv - Genomics 2021Quote: ... 22 µl of Omega Mag-Bind Total Pure NGS Beads (Omega Bio-tek, Cat. No. M1378) were added to each reaction and mixed ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were then subsequently purified with the EZ.N.A.® Cycle Pure PCR Purification Kit (OMEGA Bio-tek Inc), quantified ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA from SK-MEL-2 human melanoma cells was harvested for RT-qPCR and RNA sequencing using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek). The quality and quantity of the total RNA was assessed using NanoVuePlus Spectrophotometer (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product was purified (Cycle Pure Kit, E.Z.N.A., Omega Bio-tek) and digested with MluI and NcoI (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product was purified (Cycle Pure Kit, E.Z.N.A., Omega Bio-tek) and digested with MluI and BamHI (Promega ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products were cleaned (OMEGA Bio-Tek E.Z.N.A. Cycle Pure Kit), quantified (Synergy H1 Hybrid Multi-Mode Microplate Reader) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the PCR products were purified using a commercial kit (Omega Bio-Tek, USA) and were sent for Sanger nucleotide sequencing in both directions (Beijing DIA-UP BIOTECH Co. ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were then purified with EZNA Cycle Pure Kit (Omega Bio-tek) and Gibson assembled ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR product was purified using MicroElute® Cycle-Pure-Kit (Omega Bio-Tek) and ligated into the BioID plasmid using type II restriction enzymes BamHI and XhoI (New England BioLabs ...
-
bioRxiv - Zoology 2019Quote: ... Three replicates of the PCR reactions for each sample were combined and the PCR products were purified using Gel Extraction Kit (Omega Bio-Tek, USA). DNA was quantified using Qubit@ 2.0 Fluorometer (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2019Quote: ... PCR Purification and Gel Extraction Kits were obtained from Omega Bio-tek (Norcross, GA). Mouse-anti-His6 primary antibody and goat anti-mouse IgG H&L (Alexa Fluor® 488 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the PCR fragment could be purified using the E.Z.N.A Cycle Pure Kit (Omega Bio-Tek), according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Purification of DNA products was done by PCR cleanup (E.Z.N.A Cycle Pure Kit, Omega Bio-Tek) or gel extraction (QIAquick Gel Extraction Kit ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products were purified (Omega E.Z.N.A Cycle Pure kit, Omega Bio-tek Inc., Norcross GA), digested with BsrGI and AflII ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR products were gel purified using the E.Z.N.A® Cycle-Pure Kit (Omega Bio-tek) and sequenced at Macrogen (Amsterdam).
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were purified using the E.Z.N.A Cycle Pure Kit (Omega Bio-Tek, Georgia, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR products were purified with the E.Z.N.A.® Cycle Pure Kit V-spin (Omega Bio-tek). The purified PCR products and the pLSU-1.1 plasmid were digested with KpnI-HF® and BamHI-HF® (New England Biolabs® Inc.) ...
-
bioRxiv - Biochemistry 2021Quote: ... and PCR products were purified using an E.Z.N.A.® Gel Extraction Kit (Omega Bio-tek, Inc., USA). Target DNA fragment(s ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified using the EZNA® Gel Extraction Kit (Omega Bio-Tek, Doraville, USA). Sequencing libraries were generated using NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the E.Z.N.A.® Cycle Pure kit (Omega Bio-Tek, Inc, GA, USA), product concentrations were measured using the NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The final PCR products were purified using an E.Z.N.A.® Cycle-Pure Kit (Omega Bio-tek, Georgia) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA extraction for qRT-PCR was performed using an E.Z.N.A Total RNA Kit I (Omega bio-tek, USA). cDNA was synthesised with 1 μg of input RNA and iScript cDNA synthesis kit (Bio Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... Both PCR reactions were digested with DpnI and purified using an E.Z.N.A Cycle Pure Kit (Omega Bio-tek). pFA6a-mto2S338N-C-KanMX6 was generated using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplified products were purified from 1% agarose gel using E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA). Sanger sequencing was used to verify successful deletion of the target region ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: Linear templates were prepared by PCR and subsequent purification (E.Z.N.A.® Cycle Pure Kit, Omega Bio-tek, Norcross, GA). The oligomer sequences are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... then PCR products of ~1 kb were recovered from an agarose gel using an OMEGA gel-purification kit (OMEGA Bio-tek). The purified DNA fragments were cloned into pJET1.2 (CloneJET PCR Cloning Kit ...
-
bioRxiv - Microbiology 2019Quote: ... The three PCR products generated for each construct were purified using the EZNA Cycle Pure Kit (Omega Bio-tek, CA, USA) and Gibson assembled.
-
bioRxiv - Biochemistry 2023Quote: ... RT reactions were purified using magnetic beads (Mag-Bind Total Pure NGS, Omega Bio-Tek). 2A3-probed RMRP and RNase P samples were reverse transcribed using the SSII protocol.
-
bioRxiv - Synthetic Biology 2021Quote: ... all products were run on a 2 w/v% agarose gel to verify successful amplification of target and then purified using a PCR purification kit (Omega Bio-Tek). The prepared linear DNA was either directly used in cell-free and cell-free ATPS reactions or used as a template for in vitro transcription.
-
bioRxiv - Molecular Biology 2022Quote: Each of the targeted PCR amplicons obtained from the aforementioned genomic DNA templates was recovered from agarose gels using a Gel Extraction Kit (Omega Bio-Tek) and purified using a Universal DNA Purification kit (TIANGEN ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products of these flanks and pKOR1 backbone were purified using the EZNA Cycle Pure Kit (Omega Bio-tek, CA, USA) and Gibson assembled ...
-
bioRxiv - Biochemistry 2023Quote: Barcoded NGS libraries for each sorted population were generated using a two-step PCR protocol using AmpliTaq Gold (Invitrogen. The resulting PCR products were purified using Mag-Bind® TotalPure NGS beads (Omega Bio-tek) and amplified in a second PCR introducing the standard Illumina adapters ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were harvested at the indicated time points for total RNA isolation using RNA-Solv (Omega Bio-tek). For replicon assays ...
-
bioRxiv - Microbiology 2022Quote: ... Pooled PCR products were cleaned using the Mag-Bind RxnPure Plus (Omega Bio-tek) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... gel extraction kit and DNA purification kit were obtained from Omega Bio-tek, Inc ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were diluted 500 times and filtered using the DNA Mini columns with a nucleic acid-affinity membrane (Omega Bio-tek.) to decrease or remove the nucleic acid in samples ...
-
bioRxiv - Microbiology 2022Quote: ... The pooled PCR products were cleaned using the Mag-Bind RxnPure Plus (Omega Bio-tek) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The pooled PCR products were cleaned-up using the Mag-Bind RxnPure Plus (Omega Bio-tek) according to the Manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... The amount of the PCR products were normalized using Mag-bind Total Pure NGS (Omega Bio-tek) before pooling the samples ...
-
bioRxiv - Microbiology 2024Quote: PCR products were pooled and purified via SPRI bead purification (Mag-Bind Totalpure NGS, Omega Bio-tek) by addition of 0.6 x volumes of beads followed by light agitation for 5 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Tissue DNA Kits (Omega Bio-tek). Extracted DNA was quantified using Qubit fluorometry (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Tissue DNA Kit (Omega Bio-Tek). After extraction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Tissue DNA Kits (Omega Bio-tek). The presence of genomic DNA was confirmed via gel electrophoresis using a 2% agarose gel.
-
bioRxiv - Immunology 2019Quote: ... Stool kit (Omega Bio-tek, GA). Libraries were prepared using the Bioo Scientific NextFlex 16s V4 Amplicon-Seq kit (Bioo Scientific Corporation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel Extraction Kit (Omega Bio-tek). Deep sequencing libraries were generated by PCR amplification of sgRNA cassettes using sgRNA_P5_seq ...