Labshake search
Citations for Omega Bio-Tek :
1 - 50 of 573 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were purified using E.Z.N.A® PCR Cycle Pure kit (OMEGA bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Cycle Pure PCR Clean-Up Kit (Omega Bio-Tek). The purified library was sequenced on the Illumina MiSeq platform (v2 chemistry ...
-
bioRxiv - Genomics 2020Quote: ... Amplified PCR products were cleaned using magnetic beads (Mag-Bind PCR Clean-up Kit, Omega Bio-tek Inc.
-
bioRxiv - Genetics 2023Quote: ... These DNA templates were individually PCR-amplified and purified using a PCR clean-up kit (Omega Bio-tek D6492). In the FOXA1 EMSAs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were then subsequently purified with the EZ.N.A.® Cycle Pure PCR Purification Kit (OMEGA Bio-tek Inc), quantified ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA from SK-MEL-2 human melanoma cells was harvested for RT-qPCR and RNA sequencing using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek). The quality and quantity of the total RNA was assessed using NanoVuePlus Spectrophotometer (GE Healthcare ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product was purified (Cycle Pure Kit, E.Z.N.A., Omega Bio-tek) and digested with MluI and NcoI (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product was purified (Cycle Pure Kit, E.Z.N.A., Omega Bio-tek) and digested with MluI and BamHI (Promega ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products were cleaned (OMEGA Bio-Tek E.Z.N.A. Cycle Pure Kit), quantified (Synergy H1 Hybrid Multi-Mode Microplate Reader) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the PCR products were purified using a commercial kit (Omega Bio-Tek, USA) and were sent for Sanger nucleotide sequencing in both directions (Beijing DIA-UP BIOTECH Co. ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products were then purified with EZNA Cycle Pure Kit (Omega Bio-tek) and Gibson assembled ...
-
bioRxiv - Developmental Biology 2023Quote: ... PCR product was purified using MicroElute® Cycle-Pure-Kit (Omega Bio-Tek) and ligated into the BioID plasmid using type II restriction enzymes BamHI and XhoI (New England BioLabs ...
-
bioRxiv - Zoology 2019Quote: ... Three replicates of the PCR reactions for each sample were combined and the PCR products were purified using Gel Extraction Kit (Omega Bio-Tek, USA). DNA was quantified using Qubit@ 2.0 Fluorometer (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2019Quote: ... PCR Purification and Gel Extraction Kits were obtained from Omega Bio-tek (Norcross, GA). Mouse-anti-His6 primary antibody and goat anti-mouse IgG H&L (Alexa Fluor® 488 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the PCR fragment could be purified using the E.Z.N.A Cycle Pure Kit (Omega Bio-Tek), according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Purification of DNA products was done by PCR cleanup (E.Z.N.A Cycle Pure Kit, Omega Bio-Tek) or gel extraction (QIAquick Gel Extraction Kit ...
-
bioRxiv - Genetics 2023Quote: ... The PCR products were purified (Omega E.Z.N.A Cycle Pure kit, Omega Bio-tek Inc., Norcross GA), digested with BsrGI and AflII ...
-
bioRxiv - Plant Biology 2024Quote: ... The PCR products were gel purified using the E.Z.N.A® Cycle-Pure Kit (Omega Bio-tek) and sequenced at Macrogen (Amsterdam).
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were purified using the E.Z.N.A Cycle Pure Kit (Omega Bio-Tek, Georgia, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR products were purified with the E.Z.N.A.® Cycle Pure Kit V-spin (Omega Bio-tek). The purified PCR products and the pLSU-1.1 plasmid were digested with KpnI-HF® and BamHI-HF® (New England Biolabs® Inc.) ...
-
bioRxiv - Biochemistry 2021Quote: ... and PCR products were purified using an E.Z.N.A.® Gel Extraction Kit (Omega Bio-tek, Inc., USA). Target DNA fragment(s ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified using the EZNA® Gel Extraction Kit (Omega Bio-Tek, Doraville, USA). Sequencing libraries were generated using NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (New England Biolabs ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the E.Z.N.A.® Cycle Pure kit (Omega Bio-Tek, Inc, GA, USA), product concentrations were measured using the NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The final PCR products were purified using an E.Z.N.A.® Cycle-Pure Kit (Omega Bio-tek, Georgia) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: RNA extraction for qRT-PCR was performed using an E.Z.N.A Total RNA Kit I (Omega bio-tek, USA). cDNA was synthesised with 1 μg of input RNA and iScript cDNA synthesis kit (Bio Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... Both PCR reactions were digested with DpnI and purified using an E.Z.N.A Cycle Pure Kit (Omega Bio-tek). pFA6a-mto2S338N-C-KanMX6 was generated using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplified products were purified from 1% agarose gel using E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA). Sanger sequencing was used to verify successful deletion of the target region ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: Linear templates were prepared by PCR and subsequent purification (E.Z.N.A.® Cycle Pure Kit, Omega Bio-tek, Norcross, GA). The oligomer sequences are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... then PCR products of ~1 kb were recovered from an agarose gel using an OMEGA gel-purification kit (OMEGA Bio-tek). The purified DNA fragments were cloned into pJET1.2 (CloneJET PCR Cloning Kit ...
-
bioRxiv - Microbiology 2019Quote: ... The three PCR products generated for each construct were purified using the EZNA Cycle Pure Kit (Omega Bio-tek, CA, USA) and Gibson assembled.
-
bioRxiv - Biochemistry 2023Quote: ... RT reactions were purified using magnetic beads (Mag-Bind Total Pure NGS, Omega Bio-Tek). 2A3-probed RMRP and RNase P samples were reverse transcribed using the SSII protocol.
-
bioRxiv - Synthetic Biology 2021Quote: ... all products were run on a 2 w/v% agarose gel to verify successful amplification of target and then purified using a PCR purification kit (Omega Bio-Tek). The prepared linear DNA was either directly used in cell-free and cell-free ATPS reactions or used as a template for in vitro transcription.
-
bioRxiv - Molecular Biology 2022Quote: Each of the targeted PCR amplicons obtained from the aforementioned genomic DNA templates was recovered from agarose gels using a Gel Extraction Kit (Omega Bio-Tek) and purified using a Universal DNA Purification kit (TIANGEN ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products of these flanks and pKOR1 backbone were purified using the EZNA Cycle Pure Kit (Omega Bio-tek, CA, USA) and Gibson assembled ...
-
bioRxiv - Biochemistry 2023Quote: Barcoded NGS libraries for each sorted population were generated using a two-step PCR protocol using AmpliTaq Gold (Invitrogen. The resulting PCR products were purified using Mag-Bind® TotalPure NGS beads (Omega Bio-tek) and amplified in a second PCR introducing the standard Illumina adapters ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were harvested at the indicated time points for total RNA isolation using RNA-Solv (Omega Bio-tek). For replicon assays ...
-
bioRxiv - Microbiology 2022Quote: ... Pooled PCR products were cleaned using the Mag-Bind RxnPure Plus (Omega Bio-tek) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... gel extraction kit and DNA purification kit were obtained from Omega Bio-tek, Inc ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were diluted 500 times and filtered using the DNA Mini columns with a nucleic acid-affinity membrane (Omega Bio-tek.) to decrease or remove the nucleic acid in samples ...
-
bioRxiv - Microbiology 2022Quote: ... The pooled PCR products were cleaned using the Mag-Bind RxnPure Plus (Omega Bio-tek) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The pooled PCR products were cleaned-up using the Mag-Bind RxnPure Plus (Omega Bio-tek) according to the Manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... The amount of the PCR products were normalized using Mag-bind Total Pure NGS (Omega Bio-tek) before pooling the samples ...
-
bioRxiv - Microbiology 2024Quote: PCR products were pooled and purified via SPRI bead purification (Mag-Bind Totalpure NGS, Omega Bio-tek) by addition of 0.6 x volumes of beads followed by light agitation for 5 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Tissue DNA Kits (Omega Bio-tek). Extracted DNA was quantified using Qubit fluorometry (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Tissue DNA Kit (Omega Bio-Tek). After extraction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Tissue DNA Kits (Omega Bio-tek). The presence of genomic DNA was confirmed via gel electrophoresis using a 2% agarose gel.
-
bioRxiv - Immunology 2019Quote: ... Stool kit (Omega Bio-tek, GA). Libraries were prepared using the Bioo Scientific NextFlex 16s V4 Amplicon-Seq kit (Bioo Scientific Corporation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel Extraction Kit (Omega Bio-tek). Deep sequencing libraries were generated by PCR amplification of sgRNA cassettes using sgRNA_P5_seq ...
-
bioRxiv - Genetics 2021Quote: ... Tissue DNA kit (Omega Bio-Tek) following the manufacturer’s instructions ...