Labshake search
Citations for Omega Bio-Tek :
51 - 80 of 80 citations for Solid Phase Extraction since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Bacterial colonies were selected and grown in LB containing 50 µg/ml kanamycin A at 30°C for 24 hours and plasmid DNA were purified using the E.Z.N.A Plasmid Mini Extraction kit (Omega Bio-tek) based on the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... we selected by hand worms expressing reporter (myo-2p::mCherry) for RNA extraction (OMEGA Bio-Tek, Norcross, GA, USA) using the M165FC dissecting microscope (Leica ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Purification of DNA fragments from agarose gels used the MicroElute® Gel Extraction Kit (OMEGA Bio-tek, #D6294-02). DNA concentration was quantified by UV absorbance with the SpectraMax M3 microplate reader using a SpectraDrop Micro-Volume Microplate (Molecular Devices) ...
-
bioRxiv - Genomics 2020Quote: ... followed by gel electrophoresis and purification of the correct sized band of linearised plasmid with E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The resulting linearised plasmid and double stranded oligonucleotides were ligated using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA extraction from tissues or intestinal epithelial fraction was perform using EZNA® Total RNA kit (Omega Bio-tek) with bead column for more efficiency cell lyses ...
-
bioRxiv - Microbiology 2024Quote: Fluorophore-labeled DNA was generated using PCR amplification with a 5’FAM-labeled reverse primer (IDT) and an unlabelled forward primer and purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The amplified region contained the 256-bp region directly upstream of the lldA start codon ...
-
bioRxiv - Microbiology 2023Quote: ... total genomic DNA was extracted from isolates using the E.Z.N.A Bacterial DNA extraction kit (Omega Bio-Tek, GA, USA) by following the manufacturer’s instructions ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... the entire plant was frozen and ground in liquid nitrogen from which 100 mg used for total RNA extraction using E.Z.N.A.® Plant RNA Kit (Omega Bio-tek). The RNA was converted into cDNA using SuperScript IV RT (Invitrogen cat# 18090010 ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA extraction was conducted from thoracic tissues of haploid males using either Qiagen DNeasy or EZNA (Omega Bio-tek) kit followed up by RNaseA treatment ...
-
bioRxiv - Neuroscience 2020Quote: RNAs collected from tissue were extracted using Trizol-chloroform extraction followed by column based isolation using the E.Z.N.A Total RNA kit II (Omega Bio-Tek #R6934) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: DNA was extracted from supernatants twice using the Mag-Bind® Blood & Tissue DNA HDQ extraction kit (Omega Bio-Tek) according to manufacturer’s specifications in the Mag-Bind® Blood protocol with modifications ...
-
bioRxiv - Neuroscience 2020Quote: ... liver DNA from the F1 rat mothers was extracted using an EZNA Tissue DNA extraction kit (Omega Bio-tek, Norcross, GA) and assessed for SNPs in genes relevant to maternal behavior ...
-
bioRxiv - Biochemistry 2021Quote: ... to clean up templates at 37 °C for 2.5 hours and then purified by gel-extraction following the manufacturer instructions (Cat# D2500-02, OMEGA Bio-tek). Then 50 to 100 ng purified vector was added to 15 μL of the Gibson master mix prior to adding purified insert to the mix at a molar ratio of 3:1 insert per vector (a ratio of 7:1 was used when the insert was less than 500 bp) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The efficiency of primer extension was confirmed on a 1.5% agarose gel and the extended dsDNA were further purified by a Gel Extraction Kit (Omega Bio-Tek). The pre-melted DNA templates were prepared by the same procedure using tDNA primer with non-complementary sequences at the specified positions (Figs 3G ...
-
bioRxiv - Molecular Biology 2024Quote: ... the genomic DNA of gill tissues was first extracted using a mollusk DNA extraction kit (Omega Bio-tek, Norcross, GA, USA) for the qRT-PCR template ...
-
bioRxiv - Immunology 2021Quote: The mixed intestinal tissues were subjected to total DNA extraction using an E.Z.N.A.® soil kit (Omega Bio-Tek, Norcross, GA, USA). DNA concentration and purity were assayed using NanoDrop2000 ...
-
bioRxiv - Microbiology 2022Quote: Microbial genomic DNA extraction from soil samples was performed with the E.Z.N.A.® Soil DNA Kit (Omega Bio-tek, Norcross, GA, USA). DNA quality assays were performed on 1% agarose gels ...
-
bioRxiv - Zoology 2022Quote: ... the membrane was stored at −80 °C for extraction of bacterial DNA genome with an E.Z.N.ATM Mag-Bind Soil DNA Kit (OMEGA Bio-Tek, Inc., GA, USA), according to the manufacturers’ instructions.
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were fluorescently labeled at the 5′ ends with Cy5 (Yingjun Corp. China) and purified by gel extraction (OMEGA Bio-TEK). Fluorescently-labeled DNA was then detected using a Biophotometer Plus (Eppendorf ...
-
bioRxiv - Molecular Biology 2022Quote: Each of the targeted PCR amplicons obtained from the aforementioned genomic DNA templates was recovered from agarose gels using a Gel Extraction Kit (Omega Bio-Tek) and purified using a Universal DNA Purification kit (TIANGEN ...
-
bioRxiv - Plant Biology 2023Quote: ... Disk samples around infection site were taken and DNA extraction was performed using an E.Z.N.A.® Stool DNA Kit (Omega Bio-Tek, Norcross, USA). For the quantification of DNAs standard curves were prepared using primers designed as follows ...
-
bioRxiv - Zoology 2019Quote: ... Three replicates of the PCR reactions for each sample were combined and the PCR products were purified using Gel Extraction Kit (Omega Bio-Tek, USA). DNA was quantified using Qubit@ 2.0 Fluorometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2022Quote: Total RNA extraction from the mycelial samples was conducted with the E.Z.N.A.® Plant RNA kit (Omega Bio-Tek Inc. Norcross, GA, USA) according to the manufacturer’s extraction protocol with minor modifications ...
-
bioRxiv - Plant Biology 2022Quote: ... Plants were confirmed to be homozygous mutants by genomic DNA extraction from two green rosette leaves using the EZNA Plant DNA kit (Omega Bio-Tek, D3485) followed by PCR genotyping using standard Taq DNA polymerase (18038-042 ...
-
bioRxiv - Cell Biology 2024Quote: DNA was extracted from cell suspensions using the Mag-Bind® Blood & Tissue DNA HDQ extraction kit (Omega Bio-Tek, Nocross, Georgia, USA) according to manufacturer’s specifications in the Mag-Bind® Blood protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: The pDNA production obtained with the different strains was evaluated by extracting the pDNA with the MicroElute Gel Extraction Kit (Omega Bio-Tek, Inc.) and quantifying it with Qubit Invitrogen (ThermoFisher Scientific) ...
-
bioRxiv - Plant Biology 2021Quote: DNA extraction from leaf tissue was carried out using the Omega E-Z 96 Plant DNA Kit (Omega Bio-tek, Inc. Norcross, GA, USA). Samples were then genotyped at Michigan State University using an apple 20K Infinium® SNP array (Bianco et al. ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA was obtained from all BEC lines (3 Ctrl BEC and 5 SZP BEC) by phenol-chloroform extraction using RNAsolv (Omega Bio-Tek, Norcross, GA, USA). 1 μg of RNA was treated with DNase I (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... and the pelleted material was resuspended in 1-2 mL of supernatant and transferred to a microcentrifuge tube for DNA extraction using the E.Z.N.A® Bacterial DNA Kit (Omega Bio-tek, Inc. Norcross, GA, United States). The manufacturer’s Centrifugation Protocol was used with minor modifications ...