Labshake search
Citations for Omega Bio-Tek :
1 - 50 of 560 citations for Mouse Alpha 1 antitrypsin 1 3 SERPINA1C ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... Protocol 1: EZNA Tissue DNA KIT (Omega Bio-Tek, USA); Protocol 2 ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse skin and kidneys using E.Z.N.A total RNA kit I (Omega Bio-Tek) for cells and TRIzol (Invitrogen ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplified products were purified from 1% agarose gel using E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA). Sanger sequencing was used to verify successful deletion of the target region ...
-
bioRxiv - Molecular Biology 2020Quote: ... then PCR products of ~1 kb were recovered from an agarose gel using an OMEGA gel-purification kit (OMEGA Bio-tek). The purified DNA fragments were cloned into pJET1.2 (CloneJET PCR Cloning Kit ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the CRISPR-cas9 targeted Calu-3 cells using E.Z.N.A Tissue DNA Kit (Omega Bio-Tek, Norcross, GA), and the ACE2 regulatory element/sub-element region was amplified using PCR primers flanking each sgRNA location (listed in Table S2) ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from GBM-DCs and TRA-1-81+/SSEA4+ ic-GSCs using the EZNA Total RNA Kit (R6834-01 Omega Bio-Tek). Quality control ...
-
bioRxiv - Cancer Biology 2022Quote: DNA was extracted from mouse fecal using EZNA Stool DNA Kit (Omega Bio-tek, Inc. D4015-01, Norcross, GA 30071). The quantitative real-time PCR was conducted using the CFX96 Real-time PCR detection system (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted from the mouse small intestine using E.Z.N.A.™ Total RNA Kit (OMEGA bio-tek, Norcross, GA, USA) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were harvested in 1 mL RNA-Solv Reagent (Omega Bio-Tek) for RNA isolation.
-
bioRxiv - Microbiology 2020Quote: ... 100-bp and 1-kb molecular ladders (Omega Bio-tek, Norcross, GA, USA) were also added to gels ...
-
bioRxiv - Genetics 2023Quote: ... 1 µL dNTP mix (2mM each dNTP, OMEGA BIO-TEK, Cat#101414-958), 1U Choice Taq (Denville Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... For RNA extraction cells were harvested with 1 ml RNAsolv reagent (Omega Bio-Tek) per 6 well and RNA was isolated according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... gel extraction kit and DNA purification kit were obtained from Omega Bio-tek, Inc ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Tissue DNA Kits (Omega Bio-tek). Extracted DNA was quantified using Qubit fluorometry (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Tissue DNA Kit (Omega Bio-Tek). After extraction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Tissue DNA Kits (Omega Bio-tek). The presence of genomic DNA was confirmed via gel electrophoresis using a 2% agarose gel.
-
bioRxiv - Immunology 2019Quote: ... Stool kit (Omega Bio-tek, GA). Libraries were prepared using the Bioo Scientific NextFlex 16s V4 Amplicon-Seq kit (Bioo Scientific Corporation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel Extraction Kit (Omega Bio-tek). Deep sequencing libraries were generated by PCR amplification of sgRNA cassettes using sgRNA_P5_seq ...
-
bioRxiv - Genetics 2021Quote: ... Tissue DNA kit (Omega Bio-Tek) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Cycle Pure Kit (Omega Bio-tek). The insert and the empty pLSV101 vector were digested with SalI-HF and BamHI-HF (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Cycle Pure Kit (Omega Bio-tek). The AB and CD fragments were ligated with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Plant Biology 2020Quote: ... soil DNA kit (Omega Bio-Tek) disruptor tube with glass beads ...
-
bioRxiv - Plant Biology 2020Quote: ... Plant DNA Kit (Omega Bio-Tek).
-
bioRxiv - Plant Biology 2020Quote: ... soil DNA kit (Omega Bio-Tek) with two cHTR reagent washes.
-
bioRxiv - Microbiology 2020Quote: ... Cycle pure kit (Omega Bio-tek). pUCP20-pvdS plasmid carries a 742pb fragment that includes the coding region of pvdS (564 pb) ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA kit (Omega Bio-tek) and cDNA synthesized using a gene-specific reverse primer and SuperScript III First-Strand Synthesis System (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... Cycle Pure Kit (Omega Bio-Tek), while purification of the Cas9 mRNA was by lithium chloride precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... Stool DNA Kit (Omega Bio-Tek), according to the manufacturer’s pathogen detection protocol except for inclusion of six freeze-thaw cycles in kit lysis buffer as a first step ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid Mini Kit” (Omega Bio-Tek). All enzymatic catalyzation and purification steps were performed according to the manufacturer’s protocols and instructions ...
-
bioRxiv - Microbiology 2019Quote: ... bacterial DNA kit (Omega Bio-Tek) was used for genomic DNA extraction ...
-
bioRxiv - Genomics 2020Quote: ... Plant DNA kit (Omega Bio-tek) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Bacterial DNA Kit (Omega BIO-TEK) with the difficult to lyse bacteria optional protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Cycle Pure Kit (Omega BIO-TEK). Purified PCR products were sequenced at the Yale Keck Biotechnology Resource Laboratory by standard Sanger chemistry and the 515F primer as the sequencing primer.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Bacterial DNA kit (Omega Bio-tek). DNA was quantified using the QuantiFluor dsDNA system (Promega) ...
-
bioRxiv - Genetics 2021Quote: ... Tissue DNA kit (Omega Bio-tek). DNA was amplified using RBM48 specific primer pairs and amplicons were bidirectionally sequenced with the same or custom inner forward and reverse primers (Table S3) ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2021Quote: ... Cycle Pure kit (Omega Bio-Tek). 10 nM DNA fragments were incubated with purified protein in binding buffer (10 mM Tris-Cl pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... bacterial DNA kit (Omega Bio-Tek) following manufacturer instructions ...
-
bioRxiv - Immunology 2020Quote: ... FFPE RNA Kit (Omega Bio-tek). Samples were prepared using the Lexogen 3’ QuantSeq mRNA-seq Library Prep Kit FWD (Lexogen ...
-
bioRxiv - Microbiology 2020Quote: ... viral RNA kit (Omega Bio-Tek) and used to quantify viral genome present via the following RT-qPCR protocol ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA Kit (Omega bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA Kit (Omega bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Cycle Pure kit (Omega bio-tek) and used as templates for T7 in vitro transcription ...
-
bioRxiv - Microbiology 2022Quote: ... Tissue DNA Kit (Omega Bio-Tek) kit according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA kit (Omega BIO-TEK). RNA quality was assessed with a 2100 Bioanalyzer instrument (Agilent ...