Labshake search
Citations for Omega Bio-Tek :
401 - 450 of 553 citations for Mouse 20S Proteasome 20S PSM CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Purification of DNA fragments from agarose gels used the MicroElute® Gel Extraction Kit (OMEGA Bio-tek, #D6294-02). DNA concentration was quantified by UV absorbance with the SpectraMax M3 microplate reader using a SpectraDrop Micro-Volume Microplate (Molecular Devices) ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA from mice and embryos was extracted using E-Z 96® Tissue DNA Kit (Omega Bio-tek) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Total RNA was extracted using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek Inc, Norcross, GA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified product was run on 2% agarose gel and purified by OMEGA Gel purification Kit (OMEGA Bio-Tek). Next ...
-
bioRxiv - Genomics 2020Quote: ... followed by gel electrophoresis and purification of the correct sized band of linearised plasmid with E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The resulting linearised plasmid and double stranded oligonucleotides were ligated using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA from SK-MEL-2 human melanoma cells was harvested for RT-qPCR and RNA sequencing using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek). The quality and quantity of the total RNA was assessed using NanoVuePlus Spectrophotometer (GE Healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: Genomic DNA (gDNA) was extracted from FFPE tissues using Mag-Bind® FFPE DNA/RNA kit (Omega Bio-tek). The quality of the extracted gDNA was confirmed using the Agilent Genomic DNA ScreenTape Assay (Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted from all 11 cultures using the E.Z.N.A.® Bacterial DNA Kit (Omega Bio-tek, Norcross, GA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... negative control gDNA from KO and wild-type mosquitoes was purified using E.Z.N.A MicroElute Genomic DNA Kit (Omega Bio-tek). PCR reactions were performed using Phire Animal Tissue Direct PCR Kit as described above ...
-
bioRxiv - Synthetic Biology 2022Quote: Linear templates were prepared by PCR and subsequent purification (E.Z.N.A.® Cycle Pure Kit, Omega Bio-tek, Norcross, GA). The oligomer sequences are listed in Table S1 ...
-
bioRxiv - Microbiology 2022Quote: ... total RNA samples were extracted using the E.Z.N.A.® Plant RNA kit (Omega Bio-Tek Inc. Norcross, GA, USA) according to the manufacturer’s extraction protocol ...
-
bioRxiv - Microbiology 2023Quote: ... One hundred μL of the nasal wash or lung homogenates were added in 300 μL of TRK lysis buffer from E.Z.N.A Total RNA Kit (Omega Bio-tek) for RNA isolation ...
-
bioRxiv - Genetics 2022Quote: Genomic DNA was isolated from tail snips using E.Z.N.A.®Tissue DNA Kit (Omega Bio-tek, Norcross, GA, US). Genotyping was performed using polymerase chain reaction (PCR ...
-
bioRxiv - Bioengineering 2022Quote: Nucleofected cells were harvested at indicated timepoints and genomic DNA was extracted (MicroElute Genomic DNA Kit, Omega Bio-Tek). Genomic regions around CRISPR target sites were PCR amplified using Phusion polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: Nucleofected cells were harvested at designated timepoints and genomic DNA was extracted (MicroElute Genomic DNA Kit, Omega Bio-Tek). Genomic regions around CRISPR target sites were PCR amplified using primers located (whenever possible ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: DNA from large intestinal content was extracted using the EZNA Stool DNA kit (Omega Bio-Tek Inc., Norcross, GA). Shallow shotgun metagenomic sequencing was performed at 2 million reads (Diversigen ...
-
bioRxiv - Systems Biology 2023Quote: Genomic DNA (gDNA) was extracted using the Mag-Bind® Blood & Tissue DNA HDQ 96 Kit (Omega Bio-tek) and quantified by the Qubit™ dsDNA Quantification Assay Kits (ThermoFisher).
-
bioRxiv - Systems Biology 2023Quote: Genomic DNA (gDNA) was extracted using the Mag-Bind® Blood & Tissue DNA HDQ 96 Kit (Omega Bio-tek) and quantified by the Qubit™ dsDNA Quantification Assay Kits (ThermoFisher).
-
bioRxiv - Developmental Biology 2022Quote: RNA was isolated from formalin fixed paraffin embedded (FFPE) tissue sections using E.Z.N.A FFPE RNA Kit (Omega Bio-Tek). The RNA integrity in FFPE blocks was determined on an Agilent TapeStation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We dissected the megagametophytes from the germinating seeds and extracted DNA with E.Z.N.A Plant DNA DS Kit (Omega BIO-TEK). We quantified the DNA concentration with NanoDrop ND-1000 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA extraction from tissues or intestinal epithelial fraction was perform using EZNA® Total RNA kit (Omega Bio-tek) with bead column for more efficiency cell lyses ...
-
bioRxiv - Genetics 2023Quote: ... These DNA templates were individually PCR-amplified and purified using a PCR clean-up kit (Omega Bio-tek D6492). In the FOXA1 EMSAs ...
-
bioRxiv - Microbiology 2023Quote: ... 8 h and 24 h post-infection by following the protocol of the E.Z.N.A Bacterial DNA Kit (Omega Bio-Tek) up to the column step and then performing phenol-chloroform DNA extraction (see above ...
-
bioRxiv - Microbiology 2023Quote: ... oneidensis MR-1 cells infected with a mixed Dolos- and pDolos-containing supernatant was isolated using E.Z.N.A Bacterial DNA Kit (Omega Bio-Tek). Hence ...
-
bioRxiv - Genomics 2023Quote: ... foot/mantle and visceral body were performed using the E.Z.N.A.® HP Total RNA Isolation Kit (Omega Bio-tek). Three RNA extractions passing QC (RIN > 9 ...
-
bioRxiv - Microbiology 2024Quote: Fluorophore-labeled DNA was generated using PCR amplification with a 5’FAM-labeled reverse primer (IDT) and an unlabelled forward primer and purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The amplified region contained the 256-bp region directly upstream of the lldA start codon ...
-
bioRxiv - Genomics 2024Quote: ... Plasmid DNA was isolated from bacterial colonies using the EZNA Plasmid DNA Mini Kit I (Omega Bio-Tek Inc.), sequenced ...
-
bioRxiv - Microbiology 2024Quote: ... genomic DNA of all samples was also extracted using the E.Z.N.A® Soil DNA Kit (Omega Bio-Tek, USA), and the content and quality of the extracted DNA were detected via 1% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was isolated from dissected tissues with a Mag-Bind Viral DNA/RNA 96 Kit (Omega Bio-tek Inc) and Kingfisher Flex automated nucleic acid extraction device (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... total genomic DNA was extracted from isolates using the E.Z.N.A Bacterial DNA extraction kit (Omega Bio-Tek, GA, USA) by following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and total DNA was extracted using the E.Z.N.A.® Fungal DNA Mini Kit (Omega Bio-tek, Norcross, Georgia, USA) according to manufacturer instructions ...
-
bioRxiv - Genetics 2021Quote: ... and DNA was then extracted from the liberated occlusion-derived virus particles using a DNA isolation kit (Omega Bio-tek) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... the entire plant was frozen and ground in liquid nitrogen from which 100 mg used for total RNA extraction using E.Z.N.A.® Plant RNA Kit (Omega Bio-tek). The RNA was converted into cDNA using SuperScript IV RT (Invitrogen cat# 18090010 ...
-
bioRxiv - Neuroscience 2020Quote: RNAs collected from tissue were extracted using Trizol-chloroform extraction followed by column based isolation using the E.Z.N.A Total RNA kit II (Omega Bio-Tek #R6934) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: The genomic DNA of WSSV was extracted from crab muscle with a SQ tissue DNA kit (Omega Bio-tek, USA) according to manufacturer’s instruction ...
-
bioRxiv - Zoology 2021Quote: Total DNA was extracted from cecal contents with an E.Z.N.A.® Soil DNA kit (Omega Bio-Tek, Norcross, GA, U.S.) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 100-200 mg of stool using the E.Z.N.ATM Stool kit (Omega Bio-Tek Inc, GA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Immunology 2022Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 µL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Physiology 2019Quote: Cultured muscle cells were lysed and RNA was extracted using the E.Z.N.A Total RNA Kit (Omega Bio-tek, Norcross, GA) and concentration was determined through spectrophotometry ...
-
bioRxiv - Microbiology 2020Quote: Bacterial DNA was extracted from the fecal and sputum samples using the OMEGA-soil DNA Kit (Omega Bio-Tek, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... The DNA from Finnish and Estonian samples was extracted using E.Z.N.A.® SP Plant DNA Kit (Omega Bio-tek, Inc.). DNA of Scottish needles were extracted using a Qiagen DNeasy Plant kit and checked visually on a 1 % agarose gel ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted from dry needles and fresh megagametophytes using E.Z.N.A.® SP Plant DNA Kit (Omega Bio-tek, Inc.). Genotyping and array manufacturing for the screening set was performed by Thermo Fisher Scientific at Santa Clara ...
-
bioRxiv - Immunology 2021Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Immunology 2022Quote: ... hamster lung and trachea tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 µL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Microbiology 2022Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Microbiology 2022Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Microbiology 2022Quote: VSV-G-3CLpro-L RNA was isolated with E.Z.N.A.® Viral RNA Kit (Omega Bio-Tek Inc., Norcross, Georgia, USA) or NucleoSpin® RNA Virus (Macherey-Nagel GmbH ...