Labshake search
Citations for Omega Bio-Tek :
1 - 50 of 565 citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Plasmid used for cloning the sigma factor pvdS (was purified using an E.Z.N.A Plasmid mini kit I, (Q-spin) (Omega Bio-Tek). DNA was amplified with the appropriate oligonucleotides using Phusion High-Fidelity DNA polymerase (Thermo scientific ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma by using the Mag-Bind cfDNA Kit (Omega Bio-Tek). The protocol was optimized and modified to optimize yield28 ...
-
bioRxiv - Immunology 2022Quote: Total genomic DNA was extracted from human fecal samples using the E.Z.N.A.® DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) as manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: Total microbial genomic DNA was extracted from fecal samples of humans and mice using the E.Z.N.A.® DNA Kit (Omega Bio-Tek, Norcross, GA, U.S.) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted in biological triplicate per condition (0.03% and 5% CO2) using the E.Z.N.A.™ Yeast RNA Kit (Omega Bio-Tek, R6870-01) as per the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Genetics 2023Quote: ... and plasmids were isolated from the recovered cell populations using a commercial kit (OMEGA Bio-Tek E.Z.N.A. Yeast Miniprep kit) as per manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 5–7 using an EZNA Tissue Kit (Omega Bio-tek Inc.) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from 5 mg of spleen lysate using the Omega Biotek Total RNA 96 kit (Omega Bio-Tek, Norcross, GA) and a KingFisher Flex Instrument (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2019Quote: RNA from cells was extracted using EZNA Total RNA Kit I (Omega Bio-Tek) and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA was extracted from cells using an E.Z.N.A Total RNA Kit I (Omega Bio-tek) and subsequent cDNA and PCR was run using the miRCURY LNA miRNA PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: DNA was extracted from cell pellets using an EZNA Tissue DNA Kit (Omega Bio-Tek). Extracted DNA samples were subjected to quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... RNAs collected from cells were extracted using E.Z.N.A Total RNA kit I (Omega Bio-Tek #R6834) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from whole cells using EZNA total RNA kit (R6834-02, Omega Bio-Tek). For gene expression analysis ...
-
bioRxiv - Plant Biology 2023Quote: ... cordifolia cells were extracted using E.Z.N.A.TM Plant RNA kit (Omega Bio-tek Inc., Doraville, GA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA extraction from cells was performed by E.Z.N.A.β Total RNA Kit I (Omega BIO-TEK) according to the manufacturer’s instructions or extracted with TRIzolβ reagent (Thermo Fisher Scientific ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... cells were collected and RNA was isolated using the E.Z.N.A HP Total RNA Kit (Omega Bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from cells using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek) following the provided protocol for RNA extraction from cultured cells ...
-
bioRxiv - Pathology 2023Quote: ... viral RNA was extracted from the cells (E.Z.N.A. Total RNA Kit I R6834-01, Omega BIO-TEK) and quantified by RT-qPCR analysis.
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from cells using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek) following the provided protocol for RNA extraction from cultured cells ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured cells or tissues using an RNA Isolation Kit (Omega Bio-Tek, USA), and the amount and quality were evaluated by spectrophotometry on a Synergy.H1 Microplate Reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured cells or tissues using an RNA Isolation Kit (Omega Bio-Tek, USA), and the amount and quality were evaluated by spectrophotometry on a Synergy.H1 Microplate Reader (BioTek ...
-
bioRxiv - Physiology 2022Quote: Cultured muscle cells were lysed and RNA was extracted using the E.Z.N.A Total RNA Kit (Omega Bio-tek). All equipment ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total RNA of HepG2 cells was isolated with the E.Z.N.A Total RNA Kit (Omega Bio-tek, Norcross, GA).
-
bioRxiv - Cell Biology 2020Quote: Nucleofected cells were harvested at indicated timepoints and genomic DNA was extracted (MicroElute Genomic DNA Kit, Omega Bio-Tek). Genomic regions around CRISPR target sites were PCR amplified using Phusion polymerase (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA from SK-MEL-2 human melanoma cells was harvested for RT-qPCR and RNA sequencing using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek). The quality and quantity of the total RNA was assessed using NanoVuePlus Spectrophotometer (GE Healthcare ...
-
bioRxiv - Bioengineering 2022Quote: Nucleofected cells were harvested at indicated timepoints and genomic DNA was extracted (MicroElute Genomic DNA Kit, Omega Bio-Tek). Genomic regions around CRISPR target sites were PCR amplified using Phusion polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: Nucleofected cells were harvested at designated timepoints and genomic DNA was extracted (MicroElute Genomic DNA Kit, Omega Bio-Tek). Genomic regions around CRISPR target sites were PCR amplified using primers located (whenever possible ...
-
bioRxiv - Physiology 2019Quote: Cultured muscle cells were lysed and RNA was extracted using the E.Z.N.A Total RNA Kit (Omega Bio-tek, Norcross, GA) and concentration was determined through spectrophotometry ...
-
bioRxiv - Genomics 2023Quote: ... Total RNA was extracted from 100μl of cell culture supernatant using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek; #M6399-01) and eluted in 50μl of RNAse-free water ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA was extracted from RAW 264.7 cell pellets using the EZNA Total RNA kit (Omega Bio-Tek, Norcross, GA). Purity of isolated RNA was confirmed by A260/280 ratio ...
-
bioRxiv - Molecular Biology 2023Quote: All the cell pellets were thawed and the plasmids were extracted by using Plasmid Mini Kit I (Omega Bio-tek). The plasmids were then employed as the templates for sequencing library constructions ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted from the CRISPR-cas9 targeted Calu-3 cells using E.Z.N.A Tissue DNA Kit (Omega Bio-Tek, Norcross, GA), and the ACE2 regulatory element/sub-element region was amplified using PCR primers flanking each sgRNA location (listed in Table S2) ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA samples were extracted from the cell pellets using the EZNA Yeast RNA Kit (Omega Bio-tek, Doraville, CA, USA) and then sent to Shanghai Majorbio Bio-pharm Technology Co. ...
-
bioRxiv - Microbiology 2021Quote: ... Total DNA of biofilm formed on the mesh filter or cell pellets was extracted with E.Z.N.A.® Bacterial DNA Kit (Omega Bio-tek, Inc.) according to the manufacturer’s instructions.
-
bioRxiv - Zoology 2023Quote: ... genomic DNA was extracted from cell pellets using the Mag-Bind Blood and Tissue Kit (Omega Bio-Tek Inc., Norcross, GA). DNA concentrations were assessed using Picogreen and Victor x2 fluorometry (Life Technologies ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were transformed into DH5α electrocompetent cells for cloning and purification (E.Z.N.A.® Plasmid DNA Midi Kit, Omega Bio-tek, Norcross, GA) for sequencing and cell-free reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli cells by electroporation and plasmids were extracted using an E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-tek, Georgia, USA). Correct assemblies were confirmed by sequencing in association with the Massey Genome Service (Palmerston North ...
-
bioRxiv - Cell Biology 2024Quote: DNA was extracted from cell suspensions using the Mag-Bind® Blood & Tissue DNA HDQ extraction kit (Omega Bio-Tek, Nocross, Georgia, USA) according to manufacturer’s specifications in the Mag-Bind® Blood protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... was produced in DH10B cells and the plasmid purified from single-bacterial colonies using the E.Z.N.A.® Plasmid Mini Kit I (Omega Bio-tek, cat. no. D6942-01). NLFK cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Transfection reactions were carried out in 100-mm cell culture dishes with the plasmid DNA (20 μg) purified with OMEGA Plasmid Maxi Kit (Omega Bio-Tek, Norcross, GA) and 40 μl of Lipofectamine 2000 reagent (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... gel extraction kit and DNA purification kit were obtained from Omega Bio-tek, Inc ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Tissue DNA Kits (Omega Bio-tek). Extracted DNA was quantified using Qubit fluorometry (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Tissue DNA Kit (Omega Bio-Tek). After extraction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Tissue DNA Kits (Omega Bio-tek). The presence of genomic DNA was confirmed via gel electrophoresis using a 2% agarose gel.
-
bioRxiv - Immunology 2019Quote: ... Stool kit (Omega Bio-tek, GA). Libraries were prepared using the Bioo Scientific NextFlex 16s V4 Amplicon-Seq kit (Bioo Scientific Corporation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel Extraction Kit (Omega Bio-tek). Deep sequencing libraries were generated by PCR amplification of sgRNA cassettes using sgRNA_P5_seq ...
-
bioRxiv - Genetics 2021Quote: ... Tissue DNA kit (Omega Bio-Tek) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Cycle Pure Kit (Omega Bio-tek). The insert and the empty pLSV101 vector were digested with SalI-HF and BamHI-HF (New England Biolabs ...