Labshake search
Citations for Omega Bio-Tek :
351 - 400 of 552 citations for Human Alpha ketoglutarate dependent dioxygenase FTO FTO ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... appropriate bands were excised and purified using the E.Z.N.A Extraction Kit (Omega Bio-Tek, Cat#D2500-01), according to manufactures’ instructions ...
-
bioRxiv - Immunology 2022Quote: ... DNA was extracted from murine spleens using an EZNA Tissue DNA kit (Omega Bio-Tek, Georgia, USA). E ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from cells using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek) following the provided protocol for RNA extraction from cultured cells ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was isolated from the plugs using an E.Z.N.A Plant RNA kit (Omega Bio-tek, USA) with on-column DNase I digestion ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified using the EZNA® Gel Extraction Kit (Omega Bio-Tek, Doraville, USA). Sequencing libraries were generated using NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (New England Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: ... and total RNA was isolated using “A plant RNA extraction kit (Omega Bio-tek, Inc., Norcross, GA)” ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli DH10B by electroporation and harvested by miniprep (E.Z.N.A. Plasmid DNA Mini Kit II, Omega Bio-Tek). All culturing was performed in LB Lenox media (BioShop ...
-
bioRxiv - Pathology 2023Quote: ... viral RNA was extracted from the cells (E.Z.N.A. Total RNA Kit I R6834-01, Omega BIO-TEK) and quantified by RT-qPCR analysis.
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from sera using the Mag-Bind® Viral DNA/RNA Kit (Omega Bio-tek) on a KingFisher Flex extraction robot (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial genomic DNA was extracted using the E.Z.N.A Tissue DNA kit (Omega Bio-tek, Norcross, GA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the E.Z.N.A.® Cycle Pure kit (Omega Bio-Tek, Inc, GA, USA), product concentrations were measured using the NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... aureus RN4220 using the E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-Tek, Inc, GA, USA), and purified plasmids pSepiCcrAB ...
-
bioRxiv - Microbiology 2023Quote: ... The final PCR products were purified using an E.Z.N.A.® Cycle-Pure Kit (Omega Bio-tek, Georgia) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... treated overnight with DpnI and the DNA was purified using MicroElute Cycle-Pure Kit (Omega Bio-Tek). The fragments were assembled using Quantabio RepliQa HiFi assembly mix (#95190-D10 ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from cells using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek) following the provided protocol for RNA extraction from cultured cells ...
-
bioRxiv - Synthetic Biology 2021Quote: Yeast miniprep was performed using the E.Z.N.A.® Plasmid DNA Mini Kit I (OMEGA Bio-tek, #D6943-02) with slight modifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... and their plasmids isolated using a plasmid DNA Mini Kit I (OMEGA Bio-Tek, Inc., Norcross, GA, USA). The pooled ASKA plasmids (1 μL containing 30 ng DNA ...
-
bioRxiv - Microbiology 2021Quote: Total DNA was extracted using the E.Z.N.A.® Soil DNA Kit (Omega Bio-tek, Inc., Norcross, GA, USA): 250 mg of rind cheese was used for the DNA extraction ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured cells or tissues using an RNA Isolation Kit (Omega Bio-Tek, USA), and the amount and quality were evaluated by spectrophotometry on a Synergy.H1 Microplate Reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured cells or tissues using an RNA Isolation Kit (Omega Bio-Tek, USA), and the amount and quality were evaluated by spectrophotometry on a Synergy.H1 Microplate Reader (BioTek ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted from the resulting digests using the E.Z.N.A Mollusc DNA Kit (Omega Bio-tek, D3373-01), following manufacturers instructions.
-
bioRxiv - Pathology 2022Quote: Genomic DNA of Riemerella anatipestifer RA-YM was extracted using a Bacterial DNA Kit (Omega Bio-tek, USA). Then ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Ear clip tissue was then processed with the E.Z.N.A Tissue DNA kit (Omega Bio-tek, Norcross, GA, USA). We amplified the complete mitochondrial cytochrome-b (cytb ...
-
bioRxiv - Physiology 2022Quote: Cultured muscle cells were lysed and RNA was extracted using the E.Z.N.A Total RNA Kit (Omega Bio-tek). All equipment ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid extraction was performed using the E.Z.N.A® Plasmid DNA Mini Kit I (OMEGA Bio-tek, #D6943-02). Horizontal DNA electrophoresis in agarose gel was performed in 1× TAE buffer according to (Sambrook and Russell ...
-
bioRxiv - Microbiology 2020Quote: RNA extraction for qRT-PCR was performed using an E.Z.N.A Total RNA Kit I (Omega bio-tek, USA). cDNA was synthesised with 1 μg of input RNA and iScript cDNA synthesis kit (Bio Rad ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 200 μL of each supernatant from the mortality samples with the E.Z.N.A.TM Total RNA Kit I (Omega Bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Insertion of the desired construct was tested after plasmid extraction (Plasmid Mini Kit I, E.Z.N.A., Omega Bio-tek) by analytical restriction digest and sequencing (pMAD-seq-for and pMAD-seq-rev ...
-
bioRxiv - Cell Biology 2020Quote: ... Both PCR reactions were digested with DpnI and purified using an E.Z.N.A Cycle Pure Kit (Omega Bio-tek). pFA6a-mto2S338N-C-KanMX6 was generated using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA and RNA were isolated from the cerebellum using E.Z.N.A Total RNA kit (Omega Bio-tek, Norcross, GA) with minor modifications in the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted from FFPE tissues using the Mag-Bind® FFPE DNA/RNA kit (Omega Bio-tek). DNA was quantified using the Qubit dsDNA HS assay kit (Thermo Fisher) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Realtime qPCR was carried out using Perfectstart SYBR Green qPCR Master Mix kit (Omega Bio-Tek, GA, USA) with a thermal cycler (Agilent AriaMx ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using the Mag-Bind Viral DNA/RNA 96 kit (Omega Bio-Tek, Norcross, GA) on the KingFisher Flex Magnetic Particle Processor (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: Oligodendrocyte cultures were grown as above and harvested using the E.Z.N.A Total RNA Kit (Omega Bio-tek, Inc). For each 10 cm dish ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids were isolated from overnight cultures by miniprep (E.Z.N.A® Plasmid DNA Mini Kit I, Omega Bio-Tek) and sequenced by Sanger Sequencing (QuintaraBio).
-
bioRxiv - Genetics 2023Quote: DNA was extracted from young leaf tissue using the Mag-Bind Plant DNA Plus kit (Omega Bio-Tek; https://www.omegabiotek.com/product/mag-bind-plant-dna-plus-96-kit/) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Plasmids were isolated from these “positive hits” using the EZNA Plasmid DNA Mini Kit I (Omega Bio-Tek), sequenced using Sanger sequencing (Eurofins ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Total RNA was isolated from ground tissue powder using an E.Z.N.A Total RNA Kit II (Omega BIO-TEK). RNA purity was assessed with Nanodrop ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total RNA of HepG2 cells was isolated with the E.Z.N.A Total RNA Kit (Omega Bio-tek, Norcross, GA).
-
bioRxiv - Microbiology 2024Quote: Soil total DNA was extracted using the E.Z.N.A.® soil DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: Total nucleic acids were extracted using the HP Virus DNA/RNA Kit (R6873; Omega Bio-Tek, Norcross, USA), and carrier RNA was not used during the process to avoid potential interference with sequencing results ...
-
bioRxiv - Cell Biology 2020Quote: Nucleofected cells were harvested at indicated timepoints and genomic DNA was extracted (MicroElute Genomic DNA Kit, Omega Bio-Tek). Genomic regions around CRISPR target sites were PCR amplified using Phusion polymerase (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplified products were purified from 1% agarose gel using E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA). Sanger sequencing was used to verify successful deletion of the target region ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was extracted from 100 μl of culture supernatant using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek) and eluted in 50 μl of RNAse-free water ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid used for cloning the sigma factor pvdS (was purified using an E.Z.N.A Plasmid mini kit I, (Q-spin) (Omega Bio-Tek). DNA was amplified with the appropriate oligonucleotides using Phusion High-Fidelity DNA polymerase (Thermo scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial colonies were selected and grown in LB containing 50 µg/ml kanamycin A at 30°C for 24 hours and plasmid DNA were purified using the E.Z.N.A Plasmid Mini Extraction kit (Omega Bio-tek) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The freeze-dried lungs were then bead beaten with 2.3mm Zirconia beads and DNA was extracted using the E.Z.N.A.® Fungal DNA Mini Kit (Omega Bio-tek) with the following modifications ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from single samples using the E.Z.N.A.® Bacterial DNA Kit (Omega Bio-tek, GA, U.S.) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Purification of DNA fragments from agarose gels used the MicroElute® Gel Extraction Kit (OMEGA Bio-tek, #D6294-02). DNA concentration was quantified by UV absorbance with the SpectraMax M3 microplate reader using a SpectraDrop Micro-Volume Microplate (Molecular Devices) ...