Labshake search
Citations for Omega Bio-Tek :
351 - 400 of 552 citations for Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA was isolated from the plugs using an E.Z.N.A Plant RNA kit (Omega Bio-tek, USA) with on-column DNase I digestion ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified using the EZNA® Gel Extraction Kit (Omega Bio-Tek, Doraville, USA). Sequencing libraries were generated using NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (New England Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: ... and total RNA was isolated using “A plant RNA extraction kit (Omega Bio-tek, Inc., Norcross, GA)” ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli DH10B by electroporation and harvested by miniprep (E.Z.N.A. Plasmid DNA Mini Kit II, Omega Bio-Tek). All culturing was performed in LB Lenox media (BioShop ...
-
bioRxiv - Pathology 2023Quote: ... viral RNA was extracted from the cells (E.Z.N.A. Total RNA Kit I R6834-01, Omega BIO-TEK) and quantified by RT-qPCR analysis.
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from sera using the Mag-Bind® Viral DNA/RNA Kit (Omega Bio-tek) on a KingFisher Flex extraction robot (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Bacterial genomic DNA was extracted using the E.Z.N.A Tissue DNA kit (Omega Bio-tek, Norcross, GA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the E.Z.N.A.® Cycle Pure kit (Omega Bio-Tek, Inc, GA, USA), product concentrations were measured using the NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... aureus RN4220 using the E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-Tek, Inc, GA, USA), and purified plasmids pSepiCcrAB ...
-
bioRxiv - Microbiology 2023Quote: ... The final PCR products were purified using an E.Z.N.A.® Cycle-Pure Kit (Omega Bio-tek, Georgia) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... treated overnight with DpnI and the DNA was purified using MicroElute Cycle-Pure Kit (Omega Bio-Tek). The fragments were assembled using Quantabio RepliQa HiFi assembly mix (#95190-D10 ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from cells using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek) following the provided protocol for RNA extraction from cultured cells ...
-
bioRxiv - Synthetic Biology 2021Quote: Yeast miniprep was performed using the E.Z.N.A.® Plasmid DNA Mini Kit I (OMEGA Bio-tek, #D6943-02) with slight modifications ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma by using the Mag-Bind cfDNA Kit (Omega Bio-Tek). The protocol was optimized and modified to optimize yield28 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and their plasmids isolated using a plasmid DNA Mini Kit I (OMEGA Bio-Tek, Inc., Norcross, GA, USA). The pooled ASKA plasmids (1 μL containing 30 ng DNA ...
-
bioRxiv - Microbiology 2021Quote: Total DNA was extracted using the E.Z.N.A.® Soil DNA Kit (Omega Bio-tek, Inc., Norcross, GA, USA): 250 mg of rind cheese was used for the DNA extraction ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured cells or tissues using an RNA Isolation Kit (Omega Bio-Tek, USA), and the amount and quality were evaluated by spectrophotometry on a Synergy.H1 Microplate Reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured cells or tissues using an RNA Isolation Kit (Omega Bio-Tek, USA), and the amount and quality were evaluated by spectrophotometry on a Synergy.H1 Microplate Reader (BioTek ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted from the resulting digests using the E.Z.N.A Mollusc DNA Kit (Omega Bio-tek, D3373-01), following manufacturers instructions.
-
bioRxiv - Pathology 2022Quote: Genomic DNA of Riemerella anatipestifer RA-YM was extracted using a Bacterial DNA Kit (Omega Bio-tek, USA). Then ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Ear clip tissue was then processed with the E.Z.N.A Tissue DNA kit (Omega Bio-tek, Norcross, GA, USA). We amplified the complete mitochondrial cytochrome-b (cytb ...
-
bioRxiv - Physiology 2022Quote: Cultured muscle cells were lysed and RNA was extracted using the E.Z.N.A Total RNA Kit (Omega Bio-tek). All equipment ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid extraction was performed using the E.Z.N.A® Plasmid DNA Mini Kit I (OMEGA Bio-tek, #D6943-02). Horizontal DNA electrophoresis in agarose gel was performed in 1× TAE buffer according to (Sambrook and Russell ...
-
bioRxiv - Microbiology 2020Quote: RNA extraction for qRT-PCR was performed using an E.Z.N.A Total RNA Kit I (Omega bio-tek, USA). cDNA was synthesised with 1 μg of input RNA and iScript cDNA synthesis kit (Bio Rad ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 200 μL of each supernatant from the mortality samples with the E.Z.N.A.TM Total RNA Kit I (Omega Bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Insertion of the desired construct was tested after plasmid extraction (Plasmid Mini Kit I, E.Z.N.A., Omega Bio-tek) by analytical restriction digest and sequencing (pMAD-seq-for and pMAD-seq-rev ...
-
bioRxiv - Cell Biology 2020Quote: ... Both PCR reactions were digested with DpnI and purified using an E.Z.N.A Cycle Pure Kit (Omega Bio-tek). pFA6a-mto2S338N-C-KanMX6 was generated using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA and RNA were isolated from the cerebellum using E.Z.N.A Total RNA kit (Omega Bio-tek, Norcross, GA) with minor modifications in the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted from FFPE tissues using the Mag-Bind® FFPE DNA/RNA kit (Omega Bio-tek). DNA was quantified using the Qubit dsDNA HS assay kit (Thermo Fisher) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Realtime qPCR was carried out using Perfectstart SYBR Green qPCR Master Mix kit (Omega Bio-Tek, GA, USA) with a thermal cycler (Agilent AriaMx ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using the Mag-Bind Viral DNA/RNA 96 kit (Omega Bio-Tek, Norcross, GA) on the KingFisher Flex Magnetic Particle Processor (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: Oligodendrocyte cultures were grown as above and harvested using the E.Z.N.A Total RNA Kit (Omega Bio-tek, Inc). For each 10 cm dish ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids were isolated from overnight cultures by miniprep (E.Z.N.A® Plasmid DNA Mini Kit I, Omega Bio-Tek) and sequenced by Sanger Sequencing (QuintaraBio).
-
bioRxiv - Genetics 2023Quote: DNA was extracted from young leaf tissue using the Mag-Bind Plant DNA Plus kit (Omega Bio-Tek; https://www.omegabiotek.com/product/mag-bind-plant-dna-plus-96-kit/) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Plasmids were isolated from these “positive hits” using the EZNA Plasmid DNA Mini Kit I (Omega Bio-Tek), sequenced using Sanger sequencing (Eurofins ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total RNA of HepG2 cells was isolated with the E.Z.N.A Total RNA Kit (Omega Bio-tek, Norcross, GA).
-
bioRxiv - Evolutionary Biology 2024Quote: ... Total RNA was isolated from ground tissue powder using an E.Z.N.A Total RNA Kit II (Omega BIO-TEK). RNA purity was assessed with Nanodrop ...
-
bioRxiv - Microbiology 2024Quote: Soil total DNA was extracted using the E.Z.N.A.® soil DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: Total nucleic acids were extracted using the HP Virus DNA/RNA Kit (R6873; Omega Bio-Tek, Norcross, USA), and carrier RNA was not used during the process to avoid potential interference with sequencing results ...
-
bioRxiv - Cell Biology 2020Quote: Nucleofected cells were harvested at indicated timepoints and genomic DNA was extracted (MicroElute Genomic DNA Kit, Omega Bio-Tek). Genomic regions around CRISPR target sites were PCR amplified using Phusion polymerase (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplified products were purified from 1% agarose gel using E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA). Sanger sequencing was used to verify successful deletion of the target region ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was extracted from 100 μl of culture supernatant using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek) and eluted in 50 μl of RNAse-free water ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid used for cloning the sigma factor pvdS (was purified using an E.Z.N.A Plasmid mini kit I, (Q-spin) (Omega Bio-Tek). DNA was amplified with the appropriate oligonucleotides using Phusion High-Fidelity DNA polymerase (Thermo scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial colonies were selected and grown in LB containing 50 µg/ml kanamycin A at 30°C for 24 hours and plasmid DNA were purified using the E.Z.N.A Plasmid Mini Extraction kit (Omega Bio-tek) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The freeze-dried lungs were then bead beaten with 2.3mm Zirconia beads and DNA was extracted using the E.Z.N.A.® Fungal DNA Mini Kit (Omega Bio-tek) with the following modifications ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from single samples using the E.Z.N.A.® Bacterial DNA Kit (Omega Bio-tek, GA, U.S.) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Purification of DNA fragments from agarose gels used the MicroElute® Gel Extraction Kit (OMEGA Bio-tek, #D6294-02). DNA concentration was quantified by UV absorbance with the SpectraMax M3 microplate reader using a SpectraDrop Micro-Volume Microplate (Molecular Devices) ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA from mice and embryos was extracted using E-Z 96® Tissue DNA Kit (Omega Bio-tek) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Total RNA was extracted using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek Inc, Norcross, GA, USA) according to the manufacturer’s instructions ...