Labshake search
Citations for Omega Bio-Tek :
201 - 250 of 577 citations for DNA Damage 8 OHdG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Plasmids were purified from positive DH5α colonies with ENZA plasmid DNA mini kit (Omega Bio-Tek) and submitted to Genewiz for sequencing ...
-
bioRxiv - Microbiology 2019Quote: ... Confirmed plasmids were purified using the EZNA Plasmid DNA Mini Kit (Omega Bio-tek, CA, USA) and transformed into S ...
-
bioRxiv - Microbiology 2022Quote: ... Confirmed plasmids were extracted using the EZNA Plasmid DNA Mini Kit (Omega Bio-tek, CA, USA) and introduced into S ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Purification of DNA products was done by PCR cleanup (E.Z.N.A Cycle Pure Kit, Omega Bio-Tek) or gel extraction (QIAquick Gel Extraction Kit ...
-
Efficient Natural Plasmid Transformation of Vibrio natriegens Enables Zero-capital Molecular BiologybioRxiv - Synthetic Biology 2023Quote: ... natriegens was accomplished using the E.Z.N.A Plasmid DNA Mini Kit I produced by Omega Bio-Tek, following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were routinely purified using the E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-Tek). Plasmid constructions were carried out in E ...
-
bioRxiv - Biochemistry 2023Quote: ... the E.Z.N.A® Plasmid DNA Mini Kit was obtained from Omega Bio-Tek (Cat. # D6945-01).
-
bioRxiv - Bioengineering 2019Quote: Plasmid DNA was purified using with either E.Z.N.A.® Endo Free Plasmid Mini Kit II or Midi Kit (Omega Bio-Tek D6950-01, D6915-03) and packaged into lentiviral vectors with psPAX2 (Addgene #12260 ...
-
bioRxiv - Developmental Biology 2021Quote: ... cecum and colon digesta was isolated using an E.Z.N.A.R Stool DNA Kit (Omega Bio-tek Inc., USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... or saliva-containing solution using the Mag-Bind® Viral DNA/RNA 96 kit (Omega Bio-Tek) on the KingFisher Flex Magnetic Particle processor (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... and their plasmids isolated using a plasmid DNA Mini Kit I (OMEGA Bio-tek, Norcross, GA, USA). The pooled ASKA plasmids (1 µL containing 30 ng of DNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli DH10B by electroporation and harvested by miniprep (E.Z.N.A. Plasmid DNA Mini Kit II, Omega Bio-Tek). All culturing was performed in LB Lenox media (BioShop ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from sera using the Mag-Bind® Viral DNA/RNA Kit (Omega Bio-tek) on a KingFisher Flex extraction robot (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... aureus RN4220 using the E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-Tek, Inc, GA, USA), and purified plasmids pSepiCcrAB ...
-
bioRxiv - Microbiology 2024Quote: ... treated overnight with DpnI and the DNA was purified using MicroElute Cycle-Pure Kit (Omega Bio-Tek). The fragments were assembled using Quantabio RepliQa HiFi assembly mix (#95190-D10 ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: Yeast miniprep was performed using the E.Z.N.A.® Plasmid DNA Mini Kit I (OMEGA Bio-tek, #D6943-02) with slight modifications ...
-
bioRxiv - Molecular Biology 2019Quote: ... and their plasmids isolated using a plasmid DNA Mini Kit I (OMEGA Bio-Tek, Inc., Norcross, GA, USA). The pooled ASKA plasmids (1 μL containing 30 ng DNA ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Ear clip tissue was then processed with the E.Z.N.A Tissue DNA kit (Omega Bio-tek, Norcross, GA, USA). We amplified the complete mitochondrial cytochrome-b (cytb ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid extraction was performed using the E.Z.N.A® Plasmid DNA Mini Kit I (OMEGA Bio-tek, #D6943-02). Horizontal DNA electrophoresis in agarose gel was performed in 1× TAE buffer according to (Sambrook and Russell ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA and RNA were isolated from the cerebellum using E.Z.N.A Total RNA kit (Omega Bio-tek, Norcross, GA) with minor modifications in the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using the Mag-Bind Viral DNA/RNA 96 kit (Omega Bio-Tek, Norcross, GA) on the KingFisher Flex Magnetic Particle Processor (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids were isolated from overnight cultures by miniprep (E.Z.N.A® Plasmid DNA Mini Kit I, Omega Bio-Tek) and sequenced by Sanger Sequencing (QuintaraBio).
-
bioRxiv - Evolutionary Biology 2023Quote: ... Plasmids were isolated from these “positive hits” using the EZNA Plasmid DNA Mini Kit I (Omega Bio-Tek), sequenced using Sanger sequencing (Eurofins ...
-
bioRxiv - Microbiology 2024Quote: Total nucleic acids were extracted using the HP Virus DNA/RNA Kit (R6873; Omega Bio-Tek, Norcross, USA), and carrier RNA was not used during the process to avoid potential interference with sequencing results ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial colonies were selected and grown in LB containing 50 µg/ml kanamycin A at 30°C for 24 hours and plasmid DNA were purified using the E.Z.N.A Plasmid Mini Extraction kit (Omega Bio-tek) based on the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Purification of DNA fragments from agarose gels used the MicroElute® Gel Extraction Kit (OMEGA Bio-tek, #D6294-02). DNA concentration was quantified by UV absorbance with the SpectraMax M3 microplate reader using a SpectraDrop Micro-Volume Microplate (Molecular Devices) ...
-
bioRxiv - Microbiology 2022Quote: ... negative control gDNA from KO and wild-type mosquitoes was purified using E.Z.N.A MicroElute Genomic DNA Kit (Omega Bio-tek). PCR reactions were performed using Phire Animal Tissue Direct PCR Kit as described above ...
-
bioRxiv - Genetics 2023Quote: ... These DNA templates were individually PCR-amplified and purified using a PCR clean-up kit (Omega Bio-tek D6492). In the FOXA1 EMSAs ...
-
bioRxiv - Microbiology 2023Quote: ... 8 h and 24 h post-infection by following the protocol of the E.Z.N.A Bacterial DNA Kit (Omega Bio-Tek) up to the column step and then performing phenol-chloroform DNA extraction (see above ...
-
bioRxiv - Microbiology 2023Quote: ... oneidensis MR-1 cells infected with a mixed Dolos- and pDolos-containing supernatant was isolated using E.Z.N.A Bacterial DNA Kit (Omega Bio-Tek). Hence ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was isolated from dissected tissues with a Mag-Bind Viral DNA/RNA 96 Kit (Omega Bio-tek Inc) and Kingfisher Flex automated nucleic acid extraction device (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted in biological triplicate per condition (0.03% and 5% CO2) using the E.Z.N.A.™ Yeast RNA Kit (Omega Bio-Tek, R6870-01) as per the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 100-200 mg of stool using the E.Z.N.ATM Stool kit (Omega Bio-Tek Inc, GA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted from 500 μl of tissue slurry using the E.Z.N.A.® DNA/RNA Isolation Kit (Omega Bio-Tek) and then stored at −80°C until further processing.
-
bioRxiv - Evolutionary Biology 2024Quote: ... in combination with a magnetic bead-based method (Mag-Bind Blood & Tissue DNA HDQ kit, Omega Bio-Tek, GA, USA). Quantification of gDNA samples was conducted using a fluorometric method (Qubit ...
-
bioRxiv - Microbiology 2022Quote: Genomic DNA was extracted using a modified version of the Omega BioTek Universal Metagenomics kit protocol (OMEGA Bio-Tek, GA, USA) (see supplementary material ...
-
bioRxiv - Microbiology 2021Quote: ... Total DNA of biofilm formed on the mesh filter or cell pellets was extracted with E.Z.N.A.® Bacterial DNA Kit (Omega Bio-tek, Inc.) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... following the protocol of E-Z 96 ® Mag-Bind® Plant DNA Kit (Cat. No. M1027, Omega Bio-tek, USA).
-
bioRxiv - Zoology 2023Quote: ... genomic DNA was extracted from cell pellets using the Mag-Bind Blood and Tissue Kit (Omega Bio-Tek Inc., Norcross, GA). DNA concentrations were assessed using Picogreen and Victor x2 fluorometry (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from 5 mg of spleen lysate using the Omega Biotek Total RNA 96 kit (Omega Bio-Tek, Norcross, GA) and a KingFisher Flex Instrument (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: The mixed intestinal tissues were subjected to total DNA extraction using an E.Z.N.A.® soil kit (Omega Bio-Tek, Norcross, GA, USA). DNA concentration and purity were assayed using NanoDrop2000 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were transformed into DH5α electrocompetent cells for cloning and purification (E.Z.N.A.® Plasmid DNA Midi Kit, Omega Bio-tek, Norcross, GA) for sequencing and cell-free reaction ...
-
bioRxiv - Microbiology 2020Quote: ... The microbial DNA of fifteen soil samples was extracted from 1.0 g of each sample by the E.Z.N.A.® Soil DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) conforming to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Each of the targeted PCR amplicons obtained from the aforementioned genomic DNA templates was recovered from agarose gels using a Gel Extraction Kit (Omega Bio-Tek) and purified using a Universal DNA Purification kit (TIANGEN ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid was extracted and purified the following morning using the E.Z.N.A.® Plasmid DNA Mini Kit I Q-spin (Omega Bio-tek, Norcross, GA) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from exposed filters as well as three unexposed controls using the E.Z.N.A Soil DNA Kit (Omega Bio-tek, Norcross, GA, USA). The filters were transferred to disruptor tubes and 800 µL SLX-Mlus buffer was added ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted from 250uL of the buffy coat fraction of EDTA-treated blood using the E.Z.N.A Tissue DNA kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s protocol except 50 μL of elution buffer was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli cells by electroporation and plasmids were extracted using an E.Z.N.A.® Plasmid DNA Mini Kit I (Omega Bio-tek, Georgia, USA). Correct assemblies were confirmed by sequencing in association with the Massey Genome Service (Palmerston North ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... from approximately 460,000 pooled clones from the ASKA collection (Kitagawa et al. 2005) was isolated using an EZNA Plasmid DNA Mini Kit I (Omega Bio-Tek). Electrocompetent E ...