Labshake search
Citations for Omega Bio-Tek :
1 - 50 of 557 citations for Allopregnanolone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... were scraped off the plate and DNA was extracted using the E.Z.N.A.® Fungal HP DNA Kit (Omega Bio-Tek, Norcross, GA, USA) according to the DNA extraction procedure explained in Peris et al ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted in biological triplicate per condition (0.03% and 5% CO2) using the E.Z.N.A.™ Yeast RNA Kit (Omega Bio-Tek, R6870-01) as per the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Zoology 2020Quote: Whole genomic DNA was extracted from either the whole specimen or pereopods 5–7 using an EZNA Tissue Kit (Omega Bio-tek Inc.) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was extracted from 5 mg of spleen lysate using the Omega Biotek Total RNA 96 kit (Omega Bio-Tek, Norcross, GA) and a KingFisher Flex Instrument (ThermoFisher Scientific ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The deep well plate was sealed by AeraSeal film (Omega Bio-tek, Inc., GA) and wrapped by aluminum foil ...
-
bioRxiv - Microbiology 2020Quote: ... gel extraction kit and DNA purification kit were obtained from Omega Bio-tek, Inc ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Tissue DNA Kits (Omega Bio-tek). Extracted DNA was quantified using Qubit fluorometry (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Tissue DNA Kit (Omega Bio-Tek). After extraction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Tissue DNA Kits (Omega Bio-tek). The presence of genomic DNA was confirmed via gel electrophoresis using a 2% agarose gel.
-
bioRxiv - Immunology 2019Quote: ... Stool kit (Omega Bio-tek, GA). Libraries were prepared using the Bioo Scientific NextFlex 16s V4 Amplicon-Seq kit (Bioo Scientific Corporation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel Extraction Kit (Omega Bio-tek). Deep sequencing libraries were generated by PCR amplification of sgRNA cassettes using sgRNA_P5_seq ...
-
bioRxiv - Genetics 2021Quote: ... Tissue DNA kit (Omega Bio-Tek) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Cycle Pure Kit (Omega Bio-tek). The insert and the empty pLSV101 vector were digested with SalI-HF and BamHI-HF (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Cycle Pure Kit (Omega Bio-tek). The AB and CD fragments were ligated with T4 DNA ligase (New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Plant Biology 2020Quote: ... soil DNA kit (Omega Bio-Tek) disruptor tube with glass beads ...
-
bioRxiv - Plant Biology 2020Quote: ... Plant DNA Kit (Omega Bio-Tek).
-
bioRxiv - Plant Biology 2020Quote: ... soil DNA kit (Omega Bio-Tek) with two cHTR reagent washes.
-
bioRxiv - Microbiology 2020Quote: ... Cycle pure kit (Omega Bio-tek). pUCP20-pvdS plasmid carries a 742pb fragment that includes the coding region of pvdS (564 pb) ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA kit (Omega Bio-tek) and cDNA synthesized using a gene-specific reverse primer and SuperScript III First-Strand Synthesis System (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... Cycle Pure Kit (Omega Bio-Tek), while purification of the Cas9 mRNA was by lithium chloride precipitation ...
-
bioRxiv - Microbiology 2021Quote: ... Stool DNA Kit (Omega Bio-Tek), according to the manufacturer’s pathogen detection protocol except for inclusion of six freeze-thaw cycles in kit lysis buffer as a first step ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid Mini Kit” (Omega Bio-Tek). All enzymatic catalyzation and purification steps were performed according to the manufacturer’s protocols and instructions ...
-
bioRxiv - Microbiology 2019Quote: ... bacterial DNA kit (Omega Bio-Tek) was used for genomic DNA extraction ...
-
bioRxiv - Genomics 2020Quote: ... Plant DNA kit (Omega Bio-tek) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Bacterial DNA Kit (Omega BIO-TEK) with the difficult to lyse bacteria optional protocol ...
-
bioRxiv - Microbiology 2019Quote: ... Cycle Pure Kit (Omega BIO-TEK). Purified PCR products were sequenced at the Yale Keck Biotechnology Resource Laboratory by standard Sanger chemistry and the 515F primer as the sequencing primer.
-
bioRxiv - Evolutionary Biology 2020Quote: ... Bacterial DNA kit (Omega Bio-tek). DNA was quantified using the QuantiFluor dsDNA system (Promega) ...
-
bioRxiv - Genetics 2021Quote: ... Tissue DNA kit (Omega Bio-tek). DNA was amplified using RBM48 specific primer pairs and amplicons were bidirectionally sequenced with the same or custom inner forward and reverse primers (Table S3) ...
-
bioRxiv - Biochemistry 2021Quote: ... Gel Extraction Kit (Omega Bio-tek) after agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2021Quote: ... Cycle Pure kit (Omega Bio-Tek). 10 nM DNA fragments were incubated with purified protein in binding buffer (10 mM Tris-Cl pH 7.5 ...
-
bioRxiv - Microbiology 2021Quote: ... bacterial DNA kit (Omega Bio-Tek) following manufacturer instructions ...
-
bioRxiv - Immunology 2020Quote: ... FFPE RNA Kit (Omega Bio-tek). Samples were prepared using the Lexogen 3’ QuantSeq mRNA-seq Library Prep Kit FWD (Lexogen ...
-
bioRxiv - Microbiology 2020Quote: ... viral RNA kit (Omega Bio-Tek) and used to quantify viral genome present via the following RT-qPCR protocol ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA Kit (Omega bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA Kit (Omega bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Cycle Pure kit (Omega bio-tek) and used as templates for T7 in vitro transcription ...
-
bioRxiv - Microbiology 2022Quote: ... Tissue DNA Kit (Omega Bio-Tek) kit according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA kit (Omega BIO-TEK). RNA quality was assessed with a 2100 Bioanalyzer instrument (Agilent ...
-
bioRxiv - Plant Biology 2023Quote: ... Total RNA kit (Omega BIO-TEK) and reversely transcribed with GoScript reverse transcriptase (Promega) ...
-
bioRxiv - Plant Biology 2023Quote: ... Plant RNA Kit (Omega Bio-Tek) from sections of five roots ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cycle Pure Kit (Omega Bio-tek), and real-time PCR was performed using the QuantStudio 6 Pro system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... fungal RNA kit (Omega Bio-Tek). The quantification of RNA was performed using a Qubit 4.0 fluorometer (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Gel Extraction Kit (Omega Bio-Tek) or the ExoSAP-IT PCR Cleanup Reagent (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... Cycle Pure Kit (Omega Bio-Tek) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... DNA Tissue Kit (Omega Bio-Tek) according to the manufacturer’s instructions ...