Labshake search
Citations for Omega Bio-Tek :
401 - 450 of 598 citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured cells or tissues using an RNA Isolation Kit (Omega Bio-Tek, USA), and the amount and quality were evaluated by spectrophotometry on a Synergy.H1 Microplate Reader (BioTek ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted from the resulting digests using the E.Z.N.A Mollusc DNA Kit (Omega Bio-tek, D3373-01), following manufacturers instructions.
-
bioRxiv - Pathology 2022Quote: Genomic DNA of Riemerella anatipestifer RA-YM was extracted using a Bacterial DNA Kit (Omega Bio-tek, USA). Then ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Ear clip tissue was then processed with the E.Z.N.A Tissue DNA kit (Omega Bio-tek, Norcross, GA, USA). We amplified the complete mitochondrial cytochrome-b (cytb ...
-
bioRxiv - Physiology 2022Quote: Cultured muscle cells were lysed and RNA was extracted using the E.Z.N.A Total RNA Kit (Omega Bio-tek). All equipment ...
-
bioRxiv - Bioengineering 2020Quote: Plasmid extraction was performed using the E.Z.N.A® Plasmid DNA Mini Kit I (OMEGA Bio-tek, #D6943-02). Horizontal DNA electrophoresis in agarose gel was performed in 1× TAE buffer according to (Sambrook and Russell ...
-
bioRxiv - Microbiology 2020Quote: RNA extraction for qRT-PCR was performed using an E.Z.N.A Total RNA Kit I (Omega bio-tek, USA). cDNA was synthesised with 1 μg of input RNA and iScript cDNA synthesis kit (Bio Rad ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 200 μL of each supernatant from the mortality samples with the E.Z.N.A.TM Total RNA Kit I (Omega Bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Insertion of the desired construct was tested after plasmid extraction (Plasmid Mini Kit I, E.Z.N.A., Omega Bio-tek) by analytical restriction digest and sequencing (pMAD-seq-for and pMAD-seq-rev ...
-
bioRxiv - Cell Biology 2020Quote: ... Both PCR reactions were digested with DpnI and purified using an E.Z.N.A Cycle Pure Kit (Omega Bio-tek). pFA6a-mto2S338N-C-KanMX6 was generated using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA and RNA were isolated from the cerebellum using E.Z.N.A Total RNA kit (Omega Bio-tek, Norcross, GA) with minor modifications in the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: DNA was extracted from FFPE tissues using the Mag-Bind® FFPE DNA/RNA kit (Omega Bio-tek). DNA was quantified using the Qubit dsDNA HS assay kit (Thermo Fisher) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total RNA of HepG2 cells was isolated with the E.Z.N.A Total RNA Kit (Omega Bio-tek, Norcross, GA).
-
bioRxiv - Evolutionary Biology 2024Quote: ... Total RNA was isolated from ground tissue powder using an E.Z.N.A Total RNA Kit II (Omega BIO-TEK). RNA purity was assessed with Nanodrop ...
-
bioRxiv - Microbiology 2024Quote: Soil total DNA was extracted using the E.Z.N.A.® soil DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) following the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2024Quote: Total nucleic acids were extracted using the HP Virus DNA/RNA Kit (R6873; Omega Bio-Tek, Norcross, USA), and carrier RNA was not used during the process to avoid potential interference with sequencing results ...
-
bioRxiv - Genetics 2023Quote: DNA was extracted from young leaf tissue using the Mag-Bind Plant DNA Plus kit (Omega Bio-Tek; https://www.omegabiotek.com/product/mag-bind-plant-dna-plus-96-kit/) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Plasmids were isolated from these “positive hits” using the EZNA Plasmid DNA Mini Kit I (Omega Bio-Tek), sequenced using Sanger sequencing (Eurofins ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Realtime qPCR was carried out using Perfectstart SYBR Green qPCR Master Mix kit (Omega Bio-Tek, GA, USA) with a thermal cycler (Agilent AriaMx ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was extracted using the Mag-Bind Viral DNA/RNA 96 kit (Omega Bio-Tek, Norcross, GA) on the KingFisher Flex Magnetic Particle Processor (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: Oligodendrocyte cultures were grown as above and harvested using the E.Z.N.A Total RNA Kit (Omega Bio-tek, Inc). For each 10 cm dish ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmids were isolated from overnight cultures by miniprep (E.Z.N.A® Plasmid DNA Mini Kit I, Omega Bio-Tek) and sequenced by Sanger Sequencing (QuintaraBio).
-
bioRxiv - Microbiology 2024Quote: ... the targeted one was purified from a gel using the E.Z.N.A.® Gel Extraction Kit (Omega Bio-tek). Target amplicons were sequenced at Macrogen Europe (Amsterdam ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were then processed for DNA extraction using the E.Z.N.A.® Stool DNA Kit (Omega Bio-tek) according to the protocol provided with the kit ...
-
bioRxiv - Cell Biology 2020Quote: Nucleofected cells were harvested at indicated timepoints and genomic DNA was extracted (MicroElute Genomic DNA Kit, Omega Bio-Tek). Genomic regions around CRISPR target sites were PCR amplified using Phusion polymerase (Thermo Fisher ...
-
bioRxiv - Genetics 2021Quote: ... PCR amplified products were purified from 1% agarose gel using E.Z.N.A Gel Extraction Kit (Omega Bio-Tek, Norcross, GA). Sanger sequencing was used to verify successful deletion of the target region ...
-
bioRxiv - Microbiology 2021Quote: ... total RNA was extracted from 100 μl of culture supernatant using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek) and eluted in 50 μl of RNAse-free water ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid used for cloning the sigma factor pvdS (was purified using an E.Z.N.A Plasmid mini kit I, (Q-spin) (Omega Bio-Tek). DNA was amplified with the appropriate oligonucleotides using Phusion High-Fidelity DNA polymerase (Thermo scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial colonies were selected and grown in LB containing 50 µg/ml kanamycin A at 30°C for 24 hours and plasmid DNA were purified using the E.Z.N.A Plasmid Mini Extraction kit (Omega Bio-tek) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The freeze-dried lungs were then bead beaten with 2.3mm Zirconia beads and DNA was extracted using the E.Z.N.A.® Fungal DNA Mini Kit (Omega Bio-tek) with the following modifications ...
-
bioRxiv - Microbiology 2020Quote: ... Total DNA was extracted from single samples using the E.Z.N.A.® Bacterial DNA Kit (Omega Bio-tek, GA, U.S.) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Purification of DNA fragments from agarose gels used the MicroElute® Gel Extraction Kit (OMEGA Bio-tek, #D6294-02). DNA concentration was quantified by UV absorbance with the SpectraMax M3 microplate reader using a SpectraDrop Micro-Volume Microplate (Molecular Devices) ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA from mice and embryos was extracted using E-Z 96® Tissue DNA Kit (Omega Bio-tek) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Total RNA was extracted using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek Inc, Norcross, GA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified product was run on 2% agarose gel and purified by OMEGA Gel purification Kit (OMEGA Bio-Tek). Next ...
-
bioRxiv - Genomics 2020Quote: ... followed by gel electrophoresis and purification of the correct sized band of linearised plasmid with E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The resulting linearised plasmid and double stranded oligonucleotides were ligated using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA from SK-MEL-2 human melanoma cells was harvested for RT-qPCR and RNA sequencing using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek). The quality and quantity of the total RNA was assessed using NanoVuePlus Spectrophotometer (GE Healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: Genomic DNA (gDNA) was extracted from FFPE tissues using Mag-Bind® FFPE DNA/RNA kit (Omega Bio-tek). The quality of the extracted gDNA was confirmed using the Agilent Genomic DNA ScreenTape Assay (Agilent ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted from all 11 cultures using the E.Z.N.A.® Bacterial DNA Kit (Omega Bio-tek, Norcross, GA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... negative control gDNA from KO and wild-type mosquitoes was purified using E.Z.N.A MicroElute Genomic DNA Kit (Omega Bio-tek). PCR reactions were performed using Phire Animal Tissue Direct PCR Kit as described above ...
-
bioRxiv - Synthetic Biology 2022Quote: Linear templates were prepared by PCR and subsequent purification (E.Z.N.A.® Cycle Pure Kit, Omega Bio-tek, Norcross, GA). The oligomer sequences are listed in Table S1 ...
-
bioRxiv - Microbiology 2022Quote: ... total RNA samples were extracted using the E.Z.N.A.® Plant RNA kit (Omega Bio-Tek Inc. Norcross, GA, USA) according to the manufacturer’s extraction protocol ...
-
bioRxiv - Microbiology 2023Quote: ... One hundred μL of the nasal wash or lung homogenates were added in 300 μL of TRK lysis buffer from E.Z.N.A Total RNA Kit (Omega Bio-tek) for RNA isolation ...
-
bioRxiv - Genetics 2022Quote: Genomic DNA was isolated from tail snips using E.Z.N.A.®Tissue DNA Kit (Omega Bio-tek, Norcross, GA, US). Genotyping was performed using polymerase chain reaction (PCR ...
-
bioRxiv - Bioengineering 2022Quote: Nucleofected cells were harvested at indicated timepoints and genomic DNA was extracted (MicroElute Genomic DNA Kit, Omega Bio-Tek). Genomic regions around CRISPR target sites were PCR amplified using Phusion polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... genomic DNA of all samples was also extracted using the E.Z.N.A® Soil DNA Kit (Omega Bio-Tek, USA), and the content and quality of the extracted DNA were detected via 1% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2024Quote: Fluorophore-labeled DNA was generated using PCR amplification with a 5’FAM-labeled reverse primer (IDT) and an unlabelled forward primer and purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The amplified region contained the 256-bp region directly upstream of the lldA start codon ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was isolated from dissected tissues with a Mag-Bind Viral DNA/RNA 96 Kit (Omega Bio-tek Inc) and Kingfisher Flex automated nucleic acid extraction device (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... Plasmid DNA was isolated from bacterial colonies using the EZNA Plasmid DNA Mini Kit I (Omega Bio-Tek Inc.), sequenced ...