Labshake search
Citations for Omega Bio-Tek :
701 - 750 of 755 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... The pooled PCR products were cleaned-up using the Mag-Bind RxnPure Plus (Omega Bio-tek) according to the Manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Pooled samples were amplified using 18 cycles of PCR and size-selection was performed using 0.4× and 0.8× volumes of Mag-Bind Total Pure NGS magnetic beads (Omega Bio-Tek, Georgia, USA) to remove fragments larger than 1.5 kb and smaller than 121 bp ...
-
bioRxiv - Bioengineering 2019Quote: Plasmid DNA was purified using with either E.Z.N.A.® Endo Free Plasmid Mini Kit II or Midi Kit (Omega Bio-Tek D6950-01, D6915-03) and packaged into lentiviral vectors with psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2019Quote: ... ® soil DNA Kit (Omega Bio-tek, Norcross, GA) according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2019Quote: ... ® Stool DNA kit (Omega Bio-tek, Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... and purified using the EZNA® Cycle Pure Kit (Omega Bio-Tek). The in vitro digestion protocol was performed as described by the IDT Alt-R CRISPR-Cas9 System Protocol (version September 2019 ...
-
bioRxiv - Genetics 2019Quote: ... Genomic DNA from each individual was purified using the E-Z 96 Tissue DNA Kit (Omega Bio-Tek, Inc., Norcross, GA, USA). DNA was quantitated with the Quant-iT™ PicoGreen® Assay (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... Stool kit (Omega Bio-tek, GA). Libraries were prepared using the Bioo Scientific NextFlex 16s V4 Amplicon-Seq kit (Bioo Scientific Corporation ...
-
bioRxiv - Immunology 2019Quote: ... MicroElute Total RNA kit (Omega Bio-Tek). RNA was submitted to the Genome Technology Access core at Washington University for cDNA synthesis (NuGen Pico SL ...
-
bioRxiv - Molecular Biology 2019Quote: ... and their plasmids isolated using a plasmid DNA Mini Kit I (OMEGA Bio-Tek, Inc., Norcross, GA, USA). The pooled ASKA plasmids (1 μL containing 30 ng DNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cycle Pure Kit (D6492, Omega Bio-Tek) and underwent Sanger sequencing (GENEWIZ).
-
bioRxiv - Cancer Biology 2019Quote: ... and the RNase-free DNase Set I (E1091-02, Omega Bio-Tek) to eliminate potentially contaminating DNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... Total RNA Kit I (R6834, Omega Bio-Tek) and the RNase-free DNase Set I (E1091-02 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cycle Pure Kit (D6492, Omega Bio-Tek) and underwent Sanger sequencing (GENEWIZ).
-
bioRxiv - Immunology 2019Quote: ... Viral RNA Kit (Omega Bio-tek, Norcross, GA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: Rumen fluid samples were thawed on ice and microbial DNA was extracted using a commercial DNA Kit (Omega Bio-tek, Norcross, GA, U.S.) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The resulting sgRNAs were purified using the E.Z.N.A miRNA purification kit (Omega Bio-tek, R7034-01), eluted in RNase-free water ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel Extraction Kit (Omega Bio-Tek, Cat. # D2500-02). 200 ng of purified PCR product were denatured and re-annealed in NE Buffer 2 (New England BioLabs ...
-
bioRxiv - Microbiology 2019Quote: ... Cycle Pure Kit from Omega Bio-tek. The digested and purified pSRKKm backbone was then used in a three-part NEBuilder isothermal assembly reaction (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... Soil DNA Kit D5625-01 (Omega Bio-Tek, Inc., Norcross, GA, USA), followed manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2019Quote: ... Gel Extraction Kit (Omega Bio-tek). Deep sequencing libraries were generated by PCR amplification of sgRNA cassettes using sgRNA_P5_seq ...
-
bioRxiv - Plant Biology 2019Quote: Total RNA was extracted from basal internodes of 4-week-old plants using Omega Plant RNA Mini Kit (Omega Bio-Tek). About 500 ng DNAse treated RNA was used for cDNA synthesis using qScript cDNA supermix (Quanta BioSciences) ...
-
bioRxiv - Genetics 2019Quote: ... plant RNA extraction kit (Omega Bio-Tek) from 100 mg of floral tissue from multiple plants per line ...
-
bioRxiv - Immunology 2019Quote: ... the aqueous layer was mixed with an equal volume of cold 75% ethanol and transferred to MicroElute LE RNA Columns (Omega Bio-Tek, Norcross, GA). After RNA extraction ...
-
bioRxiv - Genomics 2019Quote: ... RNA was extracted from sponge samples using E.Z.N.A Total RNA kit II (Omega Bio-Tek Inc.) according to the manufacturer’s protocol with a previous step of homogenization with liquid nitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... Stool DNA Kit (Omega Bio-Tek, Norcross, GA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... New DNA extractions for this study were obtained with an EZNA Tissue DNA Kit (Omega Bio-tek) according to the manufacturer’s protocol and stored at −20 °C for later use ...
-
bioRxiv - Genomics 2019Quote: ... Genomic DNA was extracted from immature leaf tissue using the E-Z 96 Plant DNA kit (Omega Bio-Tek, Norcross, GA, USA) with Proteinase K was added to the initial buffer ...
-
bioRxiv - Genomics 2019Quote: ... DNA was sheared using the Covaris E220 and size selected for an average insert size of 300-nt using magnetic beads (Mag-Bind® RxnPure Plus, Omega Bio-tek). Libraries were pooled and sequenced on the Novaseq at UCSF for average 8x genome coverage in the diversity panel ...
-
bioRxiv - Plant Biology 2019Quote: ... Plant RNA kit (Omega Bio-tek Inc., Norcross, Georgia, USA) using a P10 pipette tip for transfer to 1.5 ml microfuge tube ...
-
bioRxiv - Plant Biology 2019Quote: ... including the DNase I (Omega Bio-tek Inc., Norcross, Georgia, USA) digestion protocol on column ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were pooled to create sub-libraries (Fig. A2) and purified with Mag-BIND® RxnPure Plus magnetic beads (Omega Bio-tek Inc, GA, USA), following the double size selection protocol established by Bronner et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were purified with Mag-BIND® RxnPure Plus magnetic beads (Omega Bio-tek Inc, GA, USA), following the double size selection protocol established by Bronner et al ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Zoology 2019Quote: ... Three replicates of the PCR reactions for each sample were combined and the PCR products were purified using Gel Extraction Kit (Omega Bio-Tek, USA). DNA was quantified using Qubit@ 2.0 Fluorometer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... The three PCR products generated for each construct were purified using the EZNA Cycle Pure Kit (Omega Bio-tek, CA, USA) and Gibson assembled.
-
bioRxiv - Microbiology 2019Quote: ... Confirmed plasmids were purified using the EZNA Plasmid DNA Mini Kit (Omega Bio-tek, CA, USA) and transformed into S ...
-
bioRxiv - Bioengineering 2019Quote: Genomic DNA from ear tissue of founders (F0) pigs was isolated according to the protocol of the OMEGA Kit (OMEGA Bio-Tek, Georgia, USA) for PCR and southern blot analysis ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the protein was eluted with six column volumes of 0-100% gradient of elution buffer (binding buffer with 500 mM imidazole) and 2 ml fractions were collected into 96 deep well plates (Omega Bio-tek). The collected fractions were run on SDS-PAGE gel and the fractions corresponding to His10-SUMO-RelA with the least nucleic acid contamination was collected (≈5 ml ...
-
bioRxiv - Bioengineering 2019Quote: ... PCR Purification and Gel Extraction Kits were obtained from Omega Bio-tek (Norcross, GA). Mouse-anti-His6 primary antibody and goat anti-mouse IgG H&L (Alexa Fluor® 488 ...
-
bioRxiv - Genomics 2019Quote: ... Protocol 1: EZNA Tissue DNA KIT (Omega Bio-Tek, USA); Protocol 2 ...
-
bioRxiv - Physiology 2019Quote: Cultured muscle cells were lysed and RNA was extracted using the E.Z.N.A Total RNA Kit (Omega Bio-tek, Norcross, GA) and concentration was determined through spectrophotometry ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The deep well plate was sealed by AeraSeal film (Omega Bio-tek, Inc., GA) and wrapped by aluminum foil ...
-
bioRxiv - Microbiology 2019Quote: ... bacterial DNA kit (Omega Bio-Tek) was used for genomic DNA extraction ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli using an E.Z.N.A plasmid DNA kit (Omega Bio-Tek). Prepared plasmid DNA was linearized using SmaI (New England Biolabs ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 200 μL of each supernatant from the mortality samples with the E.Z.N.A.TM Total RNA Kit I (Omega Bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: RNA from cells was extracted using EZNA Total RNA Kit I (Omega Bio-Tek) and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... HP Total RNA Kit (Omega Bio-Tek, Norcross, GA, USA) and reverse-transcripted into first-strand cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
Quantitative three-dimensional nondestructive imaging of whole anaerobic ammonium-oxidizing bacteriabioRxiv - Cell Biology 2019Quote: ... ® soil DNA Kit (Omega Bio-Tek). The final DNA concentrations were determined using an ultraviolet-visible (UV-VIS ...
-
bioRxiv - Cancer Biology 2019Quote: ... Total RNA was extracted using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek Inc, Norcross, GA, USA) according to the manufacturer’s instructions ...