Labshake search
Citations for Omega Bio-Tek :
501 - 550 of 582 citations for DNA Damage 8 OHdG ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were purified using the EZNA® Gel Extraction Kit (Omega Bio-Tek, Doraville, USA). Sequencing libraries were generated using NEBNext® Ultra™ DNA Library Prep Kit for Illumina® (New England Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: ... and total RNA was isolated using “A plant RNA extraction kit (Omega Bio-tek, Inc., Norcross, GA)” ...
-
bioRxiv - Pathology 2023Quote: ... viral RNA was extracted from the cells (E.Z.N.A. Total RNA Kit I R6834-01, Omega BIO-TEK) and quantified by RT-qPCR analysis.
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the E.Z.N.A.® Cycle Pure kit (Omega Bio-Tek, Inc, GA, USA), product concentrations were measured using the NanoDrop™ 2000 Spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The final PCR products were purified using an E.Z.N.A.® Cycle-Pure Kit (Omega Bio-tek, Georgia) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA was extracted from cells using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek) following the provided protocol for RNA extraction from cultured cells ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma by using the Mag-Bind cfDNA Kit (Omega Bio-Tek). The protocol was optimized and modified to optimize yield28 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured cells or tissues using an RNA Isolation Kit (Omega Bio-Tek, USA), and the amount and quality were evaluated by spectrophotometry on a Synergy.H1 Microplate Reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured cells or tissues using an RNA Isolation Kit (Omega Bio-Tek, USA), and the amount and quality were evaluated by spectrophotometry on a Synergy.H1 Microplate Reader (BioTek ...
-
bioRxiv - Physiology 2022Quote: Cultured muscle cells were lysed and RNA was extracted using the E.Z.N.A Total RNA Kit (Omega Bio-tek). All equipment ...
-
bioRxiv - Microbiology 2020Quote: RNA extraction for qRT-PCR was performed using an E.Z.N.A Total RNA Kit I (Omega bio-tek, USA). cDNA was synthesised with 1 μg of input RNA and iScript cDNA synthesis kit (Bio Rad ...
-
bioRxiv - Microbiology 2019Quote: ... total RNA was extracted from 200 μL of each supernatant from the mortality samples with the E.Z.N.A.TM Total RNA Kit I (Omega Bio-tek) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Insertion of the desired construct was tested after plasmid extraction (Plasmid Mini Kit I, E.Z.N.A., Omega Bio-tek) by analytical restriction digest and sequencing (pMAD-seq-for and pMAD-seq-rev ...
-
bioRxiv - Cell Biology 2020Quote: ... Both PCR reactions were digested with DpnI and purified using an E.Z.N.A Cycle Pure Kit (Omega Bio-tek). pFA6a-mto2S338N-C-KanMX6 was generated using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Realtime qPCR was carried out using Perfectstart SYBR Green qPCR Master Mix kit (Omega Bio-Tek, GA, USA) with a thermal cycler (Agilent AriaMx ...
-
bioRxiv - Neuroscience 2023Quote: Oligodendrocyte cultures were grown as above and harvested using the E.Z.N.A Total RNA Kit (Omega Bio-tek, Inc). For each 10 cm dish ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Total RNA was isolated from ground tissue powder using an E.Z.N.A Total RNA Kit II (Omega BIO-TEK). RNA purity was assessed with Nanodrop ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Total RNA of HepG2 cells was isolated with the E.Z.N.A Total RNA Kit (Omega Bio-tek, Norcross, GA).
-
bioRxiv - Molecular Biology 2021Quote: ... cells were harvested in 1 mL RNA-Solv Reagent (Omega Bio-Tek) for RNA isolation.
-
bioRxiv - Microbiology 2021Quote: ... total RNA was extracted from 100 μl of culture supernatant using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek) and eluted in 50 μl of RNAse-free water ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmid used for cloning the sigma factor pvdS (was purified using an E.Z.N.A Plasmid mini kit I, (Q-spin) (Omega Bio-Tek). DNA was amplified with the appropriate oligonucleotides using Phusion High-Fidelity DNA polymerase (Thermo scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Total RNA was extracted using the E.Z.N.A.® Total RNA Kit I (Omega Bio-Tek Inc, Norcross, GA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The amplified product was run on 2% agarose gel and purified by OMEGA Gel purification Kit (OMEGA Bio-Tek). Next ...
-
bioRxiv - Genomics 2020Quote: ... followed by gel electrophoresis and purification of the correct sized band of linearised plasmid with E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The resulting linearised plasmid and double stranded oligonucleotides were ligated using Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Total RNA from SK-MEL-2 human melanoma cells was harvested for RT-qPCR and RNA sequencing using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek). The quality and quantity of the total RNA was assessed using NanoVuePlus Spectrophotometer (GE Healthcare ...
-
bioRxiv - Synthetic Biology 2022Quote: Linear templates were prepared by PCR and subsequent purification (E.Z.N.A.® Cycle Pure Kit, Omega Bio-tek, Norcross, GA). The oligomer sequences are listed in Table S1 ...
-
bioRxiv - Microbiology 2022Quote: ... total RNA samples were extracted using the E.Z.N.A.® Plant RNA kit (Omega Bio-Tek Inc. Norcross, GA, USA) according to the manufacturer’s extraction protocol ...
-
bioRxiv - Microbiology 2023Quote: ... One hundred μL of the nasal wash or lung homogenates were added in 300 μL of TRK lysis buffer from E.Z.N.A Total RNA Kit (Omega Bio-tek) for RNA isolation ...
-
bioRxiv - Developmental Biology 2022Quote: RNA was isolated from formalin fixed paraffin embedded (FFPE) tissue sections using E.Z.N.A FFPE RNA Kit (Omega Bio-Tek). The RNA integrity in FFPE blocks was determined on an Agilent TapeStation ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA extraction from tissues or intestinal epithelial fraction was perform using EZNA® Total RNA kit (Omega Bio-tek) with bead column for more efficiency cell lyses ...
-
bioRxiv - Genomics 2023Quote: ... foot/mantle and visceral body were performed using the E.Z.N.A.® HP Total RNA Isolation Kit (Omega Bio-tek). Three RNA extractions passing QC (RIN > 9 ...
-
bioRxiv - Microbiology 2024Quote: Fluorophore-labeled DNA was generated using PCR amplification with a 5’FAM-labeled reverse primer (IDT) and an unlabelled forward primer and purified using the E.Z.N.A Gel Extraction Kit (Omega Bio-tek). The amplified region contained the 256-bp region directly upstream of the lldA start codon ...
-
bioRxiv - Microbiology 2020Quote: ... 100-bp and 1-kb molecular ladders (Omega Bio-tek, Norcross, GA, USA) were also added to gels ...
-
bioRxiv - Genetics 2023Quote: ... 1 µL dNTP mix (2mM each dNTP, OMEGA BIO-TEK, Cat#101414-958), 1U Choice Taq (Denville Scientific ...
-
bioRxiv - Immunology 2021Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
Virus-mediated transient expression techniques enable genetic modification of Alopecurus myosuroidesbioRxiv - Genetics 2020Quote: ... the entire plant was frozen and ground in liquid nitrogen from which 100 mg used for total RNA extraction using E.Z.N.A.® Plant RNA Kit (Omega Bio-tek). The RNA was converted into cDNA using SuperScript IV RT (Invitrogen cat# 18090010 ...
-
bioRxiv - Neuroscience 2020Quote: RNAs collected from tissue were extracted using Trizol-chloroform extraction followed by column based isolation using the E.Z.N.A Total RNA kit II (Omega Bio-Tek #R6934) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Immunology 2022Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 µL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Physiology 2019Quote: Cultured muscle cells were lysed and RNA was extracted using the E.Z.N.A Total RNA Kit (Omega Bio-tek, Norcross, GA) and concentration was determined through spectrophotometry ...
-
bioRxiv - Immunology 2021Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Immunology 2022Quote: ... hamster lung and trachea tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 µL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Microbiology 2022Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Microbiology 2022Quote: Hamster lung tissues were collected after sacrifice and were homogenized using bead disruption (Precellys) in 350 μL TRK lysis buffer (E.Z.N.A.® Total RNA Kit, Omega Bio-tek) and centrifuged (10.000 rpm ...
-
bioRxiv - Microbiology 2022Quote: VSV-G-3CLpro-L RNA was isolated with E.Z.N.A.® Viral RNA Kit (Omega Bio-Tek Inc., Norcross, Georgia, USA) or NucleoSpin® RNA Virus (Macherey-Nagel GmbH ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The PCR products were then subsequently purified with the EZ.N.A.® Cycle Pure PCR Purification Kit (OMEGA Bio-tek Inc), quantified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and recombinant bacmids were purified using the E.Z.N.A.® Plasmid Mini Kit I (Omega Bio-tek, cat. no. D6942-01). Baculoviruses were produced by transfecting Sf9 cells with recombinant bacmids using TransIT®-Insect Transfection Reagent (Mirus ...
-
bioRxiv - Molecular Biology 2023Quote: All the cell pellets were thawed and the plasmids were extracted by using Plasmid Mini Kit I (Omega Bio-tek). The plasmids were then employed as the templates for sequencing library constructions ...
-
bioRxiv - Genomics 2023Quote: ... Total RNA was extracted from 100μl of cell culture supernatant using the E.Z.N.A Total RNA Kit I (Omega Bio-Tek; #M6399-01) and eluted in 50μl of RNAse-free water ...