Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative real-time PCR was performed using a 7900HT fast real time PCR system (Applied Biosystems) with Sybr Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2019Quote: ... Real-time PCR was performed using using a StepOnePlus™ real-time PCR system (Thermo Fisher), with SYBR Premix Ex Taq™ II (Takara) ...
-
bioRxiv - Plant Biology 2020Quote: ... The real-time PCR was performed on QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems), with the 2ΔΔCt method for relative quantification (Livak and Schmittgen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative real time PCR (qPCR) was performed in a StepOne Real Time PCR system (Applied Biosystems). Expression was normalized to the geometrical mean of HPRT1 and RPL7 housekeeping genes and log2 transformed ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative real-time PCR was performed on the QuantStudio 5 Real-Time PCR System (Applied Biosystems) using the primers listed in Table S1 ...
-
bioRxiv - Physiology 2021Quote: ... Real-time PCR was performed in the QuantStudio™ 5 Real-Time PCR System (ThermoFisher Scientific) using SYBR Green Master Mix (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... in a 96-well Real-Time PCR instrument (StepOnePlusTM Real-Time PCR System, Thermo Fisher Scientific). mRNA levels were normalised to mRNA for human β-actin ...
-
bioRxiv - Genetics 2020Quote: ... Real-time PCR was performed in a Step One Plus Real Time PCR System (Applied Biosystems) using a Taqman probe specific for the human TK2 transcript (Hs00936914 ...
-
bioRxiv - Immunology 2021Quote: ... Real-time PCR was performed using the StepOnePlus Real-time PCR system (Applied Biosystems, CA, USA) under the following conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed on Quant Studio 6 Flex Real-time PCR system (Applied Biosystems) using SYBR Green Master mix (Applied Biosystems) ...
-
bioRxiv - Physiology 2023Quote: ... Real time PCR reactions were performed using TaqMan Real-Time PCR Assays (Mm00840165_g1, Thermo Fisher Scientific) and TaqMan Fast Advanced Master Mix (4444556 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Real-time PCR was performed using a 7500 Fast Real-Time PCR System (Applied Biosystems, 4351107) with following cycling conditions ...
-
bioRxiv - Physiology 2023Quote: ... Real-time PCR was performed in a QuantStudio 12K Flex Real Time PCR System (ThermoFisher Scientific) using TaqMan™ Gene Expression Master Mix (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... real-time PCR was performed using the StepOnePlus Real-Time PCR System (Applied Biosystems, CA, USA) and the THUNDERBIRD® SYBR® qPCR Mix (QPS-201 ...
-
bioRxiv - Cancer Biology 2023Quote: Real-time PCR was conducted using a QuantStudio 5 Real-Time PCR System (Thermo Fisher, US) and qPCR SYBR Green master mix(Cloud Sequence Biotechnology Co. ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time PCR was carried out using an ABI 7500 Real-Time PCR System (Applied Biosystems). Reactions for each sample were performed in triplicate ...
-
bioRxiv - Zoology 2023Quote: ... Real-time PCR was conducted by a real-time PCR system (QuantStudio 5, Thermo Fisher, USA) with reaction conditions as follows ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative real-time PCR was performed in a 7500 Fast Real-Time PCR System (Applied Biosystems) with SYBR premix ExTaq (Tli RNaseH Plus ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time PCR was carried out on a ViiA 7 Real-Time PCR System (Thermofisher Scientific), using PowerUp SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR was performed using the 7900HT Fast Real-Time PCR System (Thermo fisher) with commercial TaqMan primers (Thermo fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using the StepOnePlus Real-Time System (Applied Biosystems). Relative quantification values were calculated with the associated StepOnePlus software ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time PCR was performed from cDNA on a StepOnePlus Real-Time PCR System (Applied Biosystems) using the PowerUp SYBR Green Master Mix (A25741 Thermo) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time quantitative PCR reactions were performed on a 7300 Real-time PCR system (Applied Biosystems) using the THUNDERBIRD SYBR qPCR Mix (Toyobo ...
-
bioRxiv - Molecular Biology 2024Quote: ... Real-time quantitative PCR reactions were performed using a 7300 Real-Time PCR System (Applied Biosystems) with QuantiTech SYBR Green PCR kit (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... and quantitative real-time PCR was performed on QuantStudio 3 real-time PCR system (Applied Biosystems) using PowerUp SYBR green master mix (Applied Biosystems) ...
-
Role of autophagy in sepsis-induced skeletal muscle dysfunction, whole-body metabolism, and survivalbioRxiv - Cell Biology 2021Quote: ... Real-time PCR detection of mRNA expression was performed using a 7500 Sequence Detection System (Applied Biosystems, Foster City, CA). Specific primers (10 μM ...
-
bioRxiv - Microbiology 2020Quote: ... One-step RT-qPCR was performed using One-Step Real-Time RT-PCR Master Mixes (Thermo Fisher Scientific, Waltham, USA) and the StepOnePlus Real Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time reverse transcription polymerase chain reactions (RT-PCRs) were performed on the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems, Life Technologies). Data were normalized to housekeeping genes (Tubulin ...
-
bioRxiv - Microbiology 2023Quote: ... Real-time PCR instrument (Applied Biosystems). Relative fold changes of mRNA levels determined by RNA-seq were normalized to the expression of the ribosomal protein gene bcrsm18 ...
-
bioRxiv - Cell Biology 2021Quote: ... 10pg of mirVana miRNA mimic miR-199a-5p (ThermoFisher, Assay ID MC10893 and 002304) was added to 0.1-0.5ug of total RNA as a spike-in control for RT-qPCR normalization ...
-
bioRxiv - Microbiology 2019Quote: ... or miR-K6-5p mimic (miRVana) with Lipofectamine RNAiMax (ThermoFisher Scientific, Cat No: 13778150) as instructed ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative reverse transcription (RT) and real-time PCR (qRT-PCR) were done using TaqMan™ RNA-to_Ct 1-Step kit (Thermo Fisher Scientific, AB 4392938) on BioRad CFX 96 Real-time systems with the following TaqManTM probes and primers purchased from Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... for quantitative real-time PCR (qRT-PCR) by using the QuantStudio 12K Flex Real-Time PCR System (Applied Biosystems). The relative expression was analyzed by using QuantStudio 12K Flex software (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed on a QuantStudio 12K Flex Real-Time PCR System (Life Technologies) with a SYBR green detection protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Pathology 2020Quote: ... 100 ng of wild-type or mutant reporter vectors were co-transfected with 20 nM miRNA (miR-574-5p or miR-574-3p) into HEK293T cells cultured in 24-well plate using lipofectamine 3000 (ThermoFisher Scientific) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... and 9.25 µL sterile water using the standard Power SYBR Green PCR Master Mix RT-PCR Protocol (Protocol Number 436721) on a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher). As positive controls for the WSP and WPCP primer sets ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time polymerase chain reaction (RT-PCR) was performed using SYBR Green PCR Master mix (Applied Technologies) on QuantStudio3 Real-Time PCR System (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR (qRT-PCR) was performed on the Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA) using the QuantiTect SYBR Green® RT-PCR kit (204243 ...
-
bioRxiv - Pathology 2023Quote: ... Quantitative RT-PCR was performed using a standard TaqMan® PCR protocol on a StepOne real time PCR System (Applied Biosystems) with primers specific for murine Dag1 ...
-
bioRxiv - Immunology 2022Quote: ... qRT-PCR was performed by a QuantStudio 6 Flex real-time PCR detection system (Applied Biosystems, Foster City, CA) with SYBR Premix Ex TaqTM II (Tli RNaseH Plus ...
-
bioRxiv - Immunology 2019Quote: ... and real-time PCR was performed with SYBR green and a StepOne Plus RT-PCR system (both Applied Biosystems). Reactions were performed in duplicate or triplicate ...
-
bioRxiv - Genomics 2019Quote: ... Quantitative real-time RT-PCR (qRT-PCR) was performed for the selected genes using Taqman® assays (Life Technologies) on LDA cards ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative Real-Time PCR (q-RT-PCR) was performed using SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific) and the ViiA 7 Real-time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2020Quote: ... and quantitative RT-PCR was performed in a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA) using SYBR Green ...
-
bioRxiv - Neuroscience 2020Quote: ... Real time RT-PCR reaction was carried out using Syber green 2X Universal PCR Master Mix (Applied Biosystems, USA) in ABI Prism 7500 sequence detection system ...
-
Vitamin D signaling orchestrates skeletal muscle metabolic flexibility by regulating its fuel choicebioRxiv - Physiology 2023Quote: ... Quantitative RT– PCR was performed using the QuantStudio-6 and -7 Flex Real-Time PCR Systems (Thermo Fisher Scientific) with SYBR® Premix Ex Taq (Tli RNase H Plus ...
-
bioRxiv - Genetics 2023Quote: ... Quantitative RT-PCR was performed on a ViiA 7 Real-Time PCR System with OptiFlex Optics System (Applied Biosystems) using PowerUp SYBR Green PCR kit (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription quantitative PCR (RT-qPCR) was run on a QuantStudio 3 real-time PCR system (Thermo Fisher Scientific) with TB Green Advantage qPCR premix (Takara Bio ...
-
bioRxiv - Immunology 2024Quote: ... and the RT-PCR reaction was performed using a Quant Studio 5 Real-Time PCR Instrument (Applied Biosystems, MA). For quantification ...