Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and qPCR was performed with gene-specific primer sets (Supplemental Table S17) and SYBR Green PCR Master Mix (Thermo Fisher Scientific). All qPCR analyses were performed on an Applied Biosystems QuantStudio 7 Flex Cycler (Thermo Fisher Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: Oligonucleotide primer sets for real-time (quantitative) PCR were designed using Vector NTI Advance 9 software (Life Technologies, Carlsbad, CA, U.S.A.). They are listed in Supplementary Table TS3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers for RT-qPCR were purchased from Life Technologies: Arg1 (Mm00475988_m1 ...
-
bioRxiv - Microbiology 2020Quote: ... RT-PCR was performed using the Superscript III One-Step RT-PCR System (Invitrogen). cDNA was first synthesised with a single primer being added and the second primer added for the PCR step ...
-
bioRxiv - Neuroscience 2023Quote: ... RT-PCR samples were prepared using Taqman 1-Step RT-PCR master mix (Invitrogen) and Taqman gene expression assays (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... real-time quantitative RT-PCR (Real-time Quantitative RT-PCR System, Thermo Fisher, USA) was used to quantify gene expression ...
-
bioRxiv - Immunology 2023Quote: ... to perform RT-PCR using the StepOnePlus RT-PCR system (ABI 7700, Applied Biosystems). We calculated the relative gene expression using the ΔCt method and normalized the data to β-actin (Actb) ...
-
bioRxiv - Genomics 2022Quote: ... HBSS (with calcium and magnesium chloride; Gibco 14025-134), and minced into 1-2mm pieces ...
-
bioRxiv - Cancer Biology 2019Quote: ... and mouse anti-RhoA (#MA1-134, 1:1,000; ThermoFisher). We measured the band density of the scanned film using ImageJ software (NIH ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative RT-PCR was conducted using primers detailed in Supplementary Table 3 with SYBR Green Master Mix (Applied Biosystems) on the StepOne Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR was carried out using primers specific (Table S1) with SYBR Green Real-Time PCR Master Mixes (Invitrogen) and the StepOnePlus Real System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... or cDNA prepared and analyzed by RT-PCR using primers to CHAC1 Taqman FAM-MGB dye (Thermo fisher #4331182) or SMAD3 Taqman FAM-MGB dye (Thermo fisher #4453320) ...
-
bioRxiv - Cell Biology 2022Quote: Samples were DNAse treated then used for RT-PCR using 500ng of Random Primers (Invitrogen, Carlsbad, California, United States) and the Super Script II kit(Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... OpenArray chips in total contained primers for 2429 targets were read on 12_K Flex RT-PCR machine (Thermo Fisher Scientific ...
-
A modular CRISPR screen identifies individual and combination pathways contributing to HIV-1 latencybioRxiv - Microbiology 2022Quote: ... and RT-PCR (Invitrogen; 18064014), respectively ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR (Applied Biosystems) was performed on cDNA samples for Ccl19 ...
-
bioRxiv - Bioengineering 2021Quote: ... The dsx and fru splicing patterns were assessed by RT-PCR using published primers 44 with Phire Tissue Direct PCR Master Mix (Thermo Scientific, ThermoFisher Scientific, France). All PCRs were performed in a Veriti 96-wells Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... Taqman primer sets were used with TaqMan Fast Advanced Master Mix (ThermoFisher) following the manufacturer’s instructions (Extended Data Table 2).
-
bioRxiv - Immunology 2021Quote: ... For genotyping an MB21D1 rs610913-specific Taqman primer set (Thermo Fisher, C_937459_20), diluted 20x ...
-
bioRxiv - Genetics 2022Quote: ... and predesigned/inventory FAM conjugated Taqman primer/probe sets (Applied Biosystems, ThermoFisher) against murine genes ...
-
bioRxiv - Genetics 2022Quote: ... and predesigned/inventory FAM conjugated Taqman primer/probe sets (Applied Biosystems, ThermoFisher) against murine genes ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... primer and probe sets (FAM/MGB-labeled) were purchased from Applied Biosystems. In some cases ...
-
bioRxiv - Microbiology 2020Quote: ... The fragments were amplified by primer sets (Table 1) and high-fidelity PCR with the Platinum SuperFi II DNA polymerase (Thermo Fisher Scientific). F8 was generated by the overlap PCR of F8A and F8B fragments to insert the HiBiT-tag at the C-terminus of N gene (Table 1) ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5) for each sample with the SYBR Green PCR Master Mix (Applied Biosystems, 4309155). Expression of AREG was calculated relative to the expression of housekeeping gene ACTB.
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5) for each sample with the SYBR Green PCR Master Mix (Applied Biosystems, 4309155). Expression of AREG was calculated relative to the expression of housekeeping gene ACTB.
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR products were created using the Superscript IV One Step RT-PCR system (Thermofisher) and primers designed based on the results of Sanger Sequencing (Table 1) ...
-
bioRxiv - Microbiology 2020Quote: ... an iterative process of RT-PCR (Superscript III platinum 1-step RT-PCR, Thermo Fisher) and topo cloning (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... RT-PCR reactions were performed using SuperScript III One-Step RT-PCR system (ThermoFisher, #12574030) following manufacturing protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... miR-122 and anti-miR-122 were purchased from Ambion and was used at 100 pmoles to transfect cells per well of a six-well plate ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... miR-146a or miR scramble control (ThermoFisher Scientific, Waltham, MA) were mixed with PEI at an N:P ratio of 25 (the ratio of moles of PEI amine groups to nucleic acid phosphate groups ...
-
bioRxiv - Genomics 2019Quote: ... a range of primers were tested (supplementary material, table S1) using Invitrogen Superscript III Platinum One-step Quantitative RT-PCR kit (Invitrogen) in a standard 25 µL reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... This single-stranded cDNA was then used to perform quantitative real-time PCR (RT- qPCR) with specific primers using a PowerUp SYBR Green Master Mix (ThermoFisher) on a 7500 Fast Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2022Quote: ... For Quantitative Real Time PCR (RT-qPCR) 100-1000 ng RNA were reverse transcribed using random hexamer primers (Thermo Fisher) and Multiscribe reverse transcriptase (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were then processed for real-time polymerase chain reaction (RT-PCR) to assess the expression of the oxytocin receptor (primers and probe assay ID: Rn00564446_g1, purchased from Life Technologies). In particular ...
-
bioRxiv - Bioengineering 2023Quote: ... and 18S rRNA primers were used to amplify cellular RNA using the QuantStudio 6 Flex RT–PCR system (Applied Biosystems). Relative quantities of viral and cellular RNA were calculated using the standard curve method ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted as described above and the region of interest was amplified using specific primer pairs and the SuperScript IV One-Step RT-PCR System (Cat# 12594100, Invitrogen). Amplified region was directly sent for overnight sequencing service at Microsynth AG ...
-
bioRxiv - Genetics 2023Quote: ... RT–PCRs of different genes using respective primers (Table S2) were performed using ABI-7300 RT–PCR with Sequence Detection System v1.4 (Applied Biosystems). Relative mRNA expression was calculated using the previously established 2−ΔΔCT method [48] ...
-
bioRxiv - Developmental Biology 2022Quote: ... The primers used for RT-qPCR are purchased from ThermoFisher Scientic ...
-
bioRxiv - Genetics 2021Quote: ... The PCR primers and SBE primers were synthesized by Thermo Fisher Scientific and purified with polyacrylamide gel electrophoresis (PAGE ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR primers were ordered from Invitrogen Ltd and ThermoFisher-Scientific (London ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR primers were synthesized by Invitrogen Inc. ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) primers (Invitrogen-ThermoFisher) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Immunology 2024Quote: Quantitative PCR (qPCR) primers (Invitrogen-ThermoFisher) were designed using Primer-BLAST (NCBI ...
-
bioRxiv - Microbiology 2020Quote: ... one-step RT-PCR was carried out using a One-step RT-PCR detection kit (Invitrogen). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using SSIII One-Step RT-PCR Kit with Platinum Taq (Invitrogen, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using SSIII One-Step RT-PCR Kit with Platinum Taq (Invitrogen, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using a SuperScript III One-Step RT–PCR kit (Thermo Fisher Scientific) and an ABI StepOnePlus PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2019Quote: ... miRNA mimics and the miR-100 isoforms miR-100-5p and miR-100-3p (all from Life Technologies) using 15 pmol PepMute reagent (SignaGen Labs ...
-
bioRxiv - Microbiology 2021Quote: ... then 10μL of the mix was used as the template for RT reaction with LigSeq-RT primer (Supplementary Table 2) and SuperScript IV RT enzyme (Invitrogen, USA), which was performed according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2020Quote: ... The obtained RNA products were converted back to DNA oligo probes via reverse transcription (RT) with common RT primer (ATCGACCCGGCATCAACGCCACGATCAGCT) conjugated with a 5’ AlexaFluor 647 using Maxima H Minus RT enzyme (Thermo Fisher). The intermediate RNA products were removed with NaOH-EDTA solution in 95 °C for 10 minutes and the single strand DNA oligo probes were purified via DNA clean & concentrator-25 (D4033 ...