Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: A genomic fragment from 4.3 kb upstream of the transcriptional start site to the last codon of MpHYP was amplified using the primer set MpHEC1_pro_F and MpHEC1_CDS_nsR and cloned into the pENTR/D-TOPO vector (Thermo Fisher), followed by LR reaction with pMpGWB301 (Ishizaki et al. ...
-
bioRxiv - Plant Biology 2022Quote: The coding sequence of MpHYP without the stop codon was amplified from Tak-1 cDNA using the primer set MpHEC1_CDS_F and MpHEC1_CDS_nsR and cloned into pENTR/D-TOPO (Thermo Fisher), followed by an LR reaction with pMpGWB313 (Ishizaki et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... Exogenous mRNA levels of transgene expression human APOE (Hs00171168_m1) commercial TaqMan® primer/probe set (Applied Biosystems). Endogenous mouse Beta-Actin (Mm02619580_g1 ...
-
bioRxiv - Microbiology 2022Quote: ... TaqMan based RT-qPCRs were implemented using the AG-Path-One Step RT-PCR Kit (Ambion). Cycling was performed on a Bio-Rad CFX96 real-time PCR detection system (BioRad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative RT–PCR (qRT–PCR) was performed using the Power SYBR Green PCR Master Mix (Applied Biosystems) on the ABI7900HTsequence detector (Applied Biosystems) ...
-
bioRxiv - Physiology 2022Quote: ... Reverse transcription PCR (RT-PCR) was performed with the Viia 7 Real-Time PCR System (Life Technologies) using SYBR Green reagent (Life Technologies) ...
-
bioRxiv - Physiology 2022Quote: ... Reverse transcription PCR (RT-PCR) was performed with the Viia 7 Real-Time PCR System (Life Technologies) using SYBR Green reagent (Life Technologies) ...
-
bioRxiv - Physiology 2023Quote: ... Reverse transcription PCR (RT-PCR) was performed with the Viia 7 Real-Time PCR System (Life Technologies) using a SYBR Green reagent (Life Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... OpenArray chips in total contained primers for 2429 targets were read on 12_K Flex RT-PCR machine (Thermo Fisher Scientific, Life Technologies Corporation, Grand Island, New York). Data analysis was performed through the online available Expression suit v 1.3 software (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... The RT-PCR assays were conducted by using SuperScript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA, USA). Amplifications were performed in an Eppendorf Master Cycler Model 5345 (Eppendorf ...
-
bioRxiv - Immunology 2021Quote: ... Beads were re-emulsified in an overlap extension RT-PCR mixture using the SuperScript III RT-PCR Kit (Thermo Fisher Scientific, Waltham, MA) with the incorporation of custom designed TCR cloning primers (Supplementary Table 2)53 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was isolated from wild type N2 animals using trizol and phenol-chloroform extraction followed by RT-PCR using Superscript III One Step RT-PCR system with Platinum Taq DNA polymerase kit (ThermoFisher Scientific cat #: 12574026) to prepare the cDNA ...
-
bioRxiv - Genetics 2022Quote: ... Total RNA was extracted from N2 animals with Trizol and phenol-chloroform prior to cDNA synthesis using RT-PCR with the Superscript III One Step RT-PCR system with Platinum Taq DNA polymerase kit (ThermoFisher Scientific cat #: 12574026). The resultant PCR product was used as a template for in vitro transcription (IVT ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed using 1 µl of eluted RNA and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThermoFisher) as described by the manufacturer.
-
bioRxiv - Plant Biology 2022Quote: ... RT-PCR was performed using the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen™, ThermoFisher) and gene-specific primers (Table 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-PCR was performed using the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen™, ThermoFisher) and gene-specific primers (Table 2 ...
-
bioRxiv - Microbiology 2023Quote: ... were used as template in a one-step RT-PCR reaction with the SuperScrip IV One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA) and primers that amplify coding sequences for Spike amino acids 614 and 655 (Table 2) ...
-
bioRxiv - Microbiology 2023Quote: ... An 800 bp fragment covering the ORF10 region was amplified by one-step RT-PCR using the SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThermoFisher) and the following primers (OL11F ...
-
bioRxiv - Microbiology 2023Quote: ... This was followed by a one-step RT-PCR reaction using the SuperScript III One-Step RT-PCR System with Platinum Taq High Fidelity DNA Polymerase (ThermoFisher, Cat. No. 12574035) and primers targeting the barcoded region (Forward 5’ – TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACCTTCTTCTTGACTCAAGGG – 3’ ...
-
bioRxiv - Genetics 2022Quote: ... We ran RT-PCR in a QuantStudio 3 Real-Time PCR machine (Thermo Fisher) using continuous capture with a 0.025°C/s ramp ...
-
bioRxiv - Genomics 2020Quote: ... RT-PCR was performed using Power SYBR Green PCR Master Mix (Life Technologies, USA) on ABI ViiA-7TM real-time PCR system with the standard relative quantification mode (2ΔΔCT ...
-
bioRxiv - Genomics 2020Quote: qRT-PCRs were performed using Ambion AgPath-ID One Step RT-PCR (Thermo Fisher) according to Centers for Disease Control and Prevention-developed singleplex real-time reverse transcription PCR (rRT-PCR ...
-
bioRxiv - Systems Biology 2021Quote: ... RT-PCR measurements were conducted using a StepOnePlus Real-Time PCR System (Thermo Scientific) with ChamQ™ Universal SYBR qPCR Master Mix (#Q711-02/03 ...
-
bioRxiv - Immunology 2022Quote: ... RT-PCR was performed using the QuantStudio 5 Real-Time PCR Systems (Applied Biosystems). An initial enzyme activation step of 2 minutes at 50°C and denaturation step of 5 minutes at 95°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... RT-PCR was run on a 7900HT Fast Real-Time PCR instrument (Applied Biosystems) with Taqman probes for FEV (assay ID ...
-
bioRxiv - Genetics 2022Quote: ... RT-PCR was performed with Phire Tissue Direct PCR Master Mix kit (Thermo Scientific) using primers 429-Gambicin-F & 430-Gambicin-R ...
-
bioRxiv - Plant Biology 2021Quote: ... Semi-quantitative reverse transcription PCR (RT-PCR) was performed using DreamTaq (Thermo Fisher Scientific) with 25 to 30 amplification cycles followed by electrophoresis with 1.8% (w/v ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative RT-PCR was performed using SYBR Green PCR Master Mix (ThermoFisher, Cat.#4312704) on a ViiA 7 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... RT-PCR was performed using the QuantStudio 5 Real-Time PCR Systems (Applied Biosystems). An initial enzyme activation step of 2 min at 50°C and denaturation step of 5 min at 95°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative RT-PCR was performed in a StepOnePlus Real-Time PCR System (Applied Biosystems) and PCR reactions contained 0.6μM forward and reverse primer ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative RT-PCR was performed on a StepOnePlus Real Time PCR System (Life Technologies) using Taqman Gene Expression Assays for Ucp1 and Tbp (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR was performed with 7900 HT fast realtime PCR system (Applied Biosystems) using gene-specific primers of candidate TFs (Table S2 ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR was performed with a 7300 Real-Time PCR system (Applied Biosystems) using SYBR Premix Ex Taq (TaKaRa) ...
-
bioRxiv - Plant Biology 2020Quote: ... Q-RT-PCR was carried out using SYBR green real time PCR mastermix (Thermofisher) and performed using Lightcycler 480 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: Quantitative RT–PCR (qRT–PCR) was performed after RNA extraction using TRIzol (Thermo Fisher). RNA expression was determined with Universal SYBR Green Two-step kit (Yeasen ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR was performed using SYBR® Green Real-Time PCR Master Mix (Invitrogen) on an Eppendorf Realplex 4S Real-time PCR system ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was performed on the StepOne Plus Real-Time PCR System (Applied Biosystems) with reagents from KAPA SYBR FAST qPCR Kit (KAPA Biosystems #KK4618) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative RT-PCR was run using SYBR Green PCR Master Mix (Thermo Fisher Scientific) using a cycling program of 10 min at 95°C followed by 40 cycles of 95°C for 15 sec and 95°C for 60 sec ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed using a StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) with specific primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-PCR amplification was performed using the 2X DreamTaq PCR mastermix (Thermo Fisher Scientific) with a cycle set up of an initial 95 °C for 2 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA synthesis and PCR were performed using SuperScript III One-step RT-PCR (Invitrogen) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... RT-PCR using Power SYBR Green PCR Master Mix (Thermo Fisher Scientific, Waltham, MA) in a Quantstudio 12K Flex real time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then emerald GFP-miR cassette was PCR amplified and subcloned into the viral expression vector pRRLsinPPT (Invitrogen). Viral particles were produced in HEK-293T cells as previously described (Thomas et al. ...
-
bioRxiv - Genomics 2021Quote: All the primers used for real-time PCR were designed by Primer Express software (Applied Biosystems, USA) and provided in Supplementary Table 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... Gene-specific primers for qRT-PCR were designed using PRIMER EXPRESS version 2.0 (PE Applied Biosystems, USA) with default parameters ...
-
bioRxiv - Plant Biology 2023Quote: ... Primers for qRT-PCR were designed using Primer Prime Plus 5 Software Version 3.0 (Applied Biosystems, USA). For internal reference ...
-
bioRxiv - Cancer Biology 2019Quote: Four miRs designed for targeting TLX and a negative control miR (BLOCK-iT™ RNAi Designer, ThermoFisher) were cloned into pcDNA3.1 and cotransfected with a vector expressing mouse TLX into HEK293T cells ...
-
bioRxiv - Microbiology 2024Quote: ... and subjected to PCR with primers (Forward primer: CCTGGATCTGAGGGAGCGA and reverse primer: AGGGCAGCGCGATTAGAAAG) using a Platinum™ Taq DNA High Fidelity polymerase (Invitrogen, Carlsbad, CA) or Platinum™ SuperFi II Green PCR Master Mix (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... MicroRNA PCR primers and probes were obtained from Thermo Fisher Scientific and are available upon request ...
-
bioRxiv - Microbiology 2021Quote: ... and the PCR primers were synthesized by Invitrogen (Shanghai, China). Overlapping-PCR based site-directed mutagenesis was employed to introducing point mutations of pyr2 ...