Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for pTH Related Protein Splice Isoform 3 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... of the homogenized protein-loading buffer sample were loaded in duplicates on a NuPAGE™ 3-8% Tris-Acetate gel (ThermoFisher) to be probed separately with FLAG and ATPase antibodies ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3% FBS (Gibco), 1% MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Genomics 2019Quote: ... 3 (Applied Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... DiOC2(3) (Invitrogen) was added to a final concentration of 30µM or DiSC3(5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% FBS (Invitrogen), 20 ng ml−1 EGF (Peprotech ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO2/3 (Invitrogen), β-catenin (BD Transduction Laboratories) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 (Applied Biosystems). We assembled forward and reverse reads using the Geneious (https://www.geneious.com ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Gibco), 0.1mM MEM-NEAA (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... Total protein was extracted by resuspending leaf tissue in 1X PBS supplemented with 3% β-mercaptoethanol and protease inhibitor cocktail (Thermo Scientific). Samples were mixed with 6X Laemmli SDS buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Solubilised proteins in a 25 μL volume were prepared and separated by electrophoresis on NativePAGE 3-12% Bis-Tris gels (Thermo Fisher Scientific) and NuPAGE Tris-Acetate buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2019Quote: ... Procaspase-3 (0.123 mg/mL protein extract) and caspase-3 (1.0 U) were assayed in 96-well microplates (Nunc™ MicroWell™ 96-Well, Thermo Scientific™ ...
-
bioRxiv - Molecular Biology 2019Quote: ... either 50 µl (Figure 2A-2C, 7 and 8) or 25 µl (Figure 2D, 2E, 3-7 and 9) magnetic beads (Dynabeads protein G, Life Technologies #10004D) was used ...
-
bioRxiv - Developmental Biology 2019Quote: ... and biotinylated at a molar ratio biotin/protein (3:1) for 30 min at room temperature (EZ-Link NHS-PEG4-Biotin (1189-1195, Fisher Scientific, Germany)) ...
-
bioRxiv - Genetics 2021Quote: ... the same procedure was used except that 20 ug of α-HA antibody (MBL 180-3) was bound to 400 ul equilibrated Protein A agarose (Invitrogen, 15918014) by rotating at room temperature for 1h and washed 3x with extraction buffer and protein was eluted 3x with 300 ul of 1 mg/mL HA peptide (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies overnight at 4°C and then incubated for an additional 3 hours at 4°C with 50 μL DynabeadsTM protein G (Life Technologies, 10004D). Following three washes with 1% Triton-TBS lysis buffer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were adjusted to 1-3 μg/μl in lysis buffer and NuPAGE 4x LDS sample buffer (NP0007) (Thermo Fisher Scientific) was added to lysates ...
-
bioRxiv - Neuroscience 2020Quote: ... Denatured samples from both the total lysates and surface fractions were separated on NuPAGE 3-8 % Tris-Acetate protein gels (Thermo Fisher Scientific) at 200 V for 40 min ...
-
bioRxiv - Immunology 2020Quote: ... were mixed by adding 3 μL of each (150 pmol) and 6 μL (180 pmol) of TruCut Cas9 Protein v2 (Thermo Fisher Scientific) and incubated for 10 minutes at room temperature ...
-
bioRxiv - Biophysics 2020Quote: ... (67)) or end-binding protein 1 (EB1)-EGFP (EB1/GFP-3; (68)) were cultured in Life Technologies Opti-MEM (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: The IGFBP-derived NLS peptides (NLS-3 and NLS-5) were extracted from the bacteria using the B-Per 6xHis Fusion Protein Purification Kit (Thermo Scientific, USA), according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... each well was washed 3 times by PBS and proteins were extracted using RIPA lysis buffer completed by protease inhibitors (Fisher Scientific, France) for 1h at 4°C ...
-
bioRxiv - Bioengineering 2019Quote: ... tissues were wash 3 times with PBS and incubate with protein blocking solution that contain 0.5% Triton X-100 (Fisher Scientific, Hampton, NH). Then tissues were incubated in 1:250 diluted primary antibody (CD31 (PECAM-1 ...
-
bioRxiv - Immunology 2020Quote: ... Cells from spleen and BMM were washed 3 times with ice-cold PBS and lysed by M-PER™ Mammalian Protein Extraction Reagent (Thermo Scientific) in the presence of protease inhibitor cocktail (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: N2A cells were transfected as described above with BicD2-KIF tail fusions and MBNL-GFP proteins at a ratio of 2:3 in 4-well chamber slides (Thermo Fisher, 154526). 24 hours after transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... the membranes were washed 3 × 5 min with TBS-T and proteins detected using Chemiluminescent Substrate (SuperSignal™ West Pico PLUS, Thermo Scientific) by acquiring images with Chemidoc (BioRad).
-
bioRxiv - Microbiology 2022Quote: ... The supernatant was transferred into a fresh tube and protein concentration was measured using the Invitrogen Qubit 3 fluorometer (Thermo Fisher Scientific). Ten µg total protein were loaded per lane.
-
bioRxiv - Cell Biology 2023Quote: ... The medium was then centrifuged at 3.9 k x g for 15 minutes and concentrated using a Pierce™ protein concentrator with a 3 kilodalton cut-off (ThermoFisher, 88526). The concentrated medium was diluted 1:5 with synthetic seawater before use ...
-
bioRxiv - Cell Biology 2023Quote: ... gastrocnemius muscle from mice trained on a treadmill for 3 h was fractionated into the cytoplasm and nucleus using the Subcellular Protein Fractionation Kit for Tissues (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... The resolved samples were run on either NuPAGE 3–8% Tris-acetate or NuPAGE 12% Bis-Tris protein gels (Thermo Fisher Scientific) with the appropriate running buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... and 200 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC) (Invitrogen) in water for 1 hour at 60°C ...
-
bioRxiv - Neuroscience 2019Quote: ... Fluo-3-acetoxymethylester (Fluo-3-AM) (Molecular Probes-Thermo Fisher Scientific) was used (Beauvais et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... Fluo-3-acetoxymethylester (Fluo-3-AM) (Molecular Probes-Thermo Fisher Scientific) was used (Beauvais et al. ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: 400000 Schneider SL2 cells were transfected with 50 ng of plasmid bearing the Srrm234 minigene (when it applies) and 3 ug of Srrm protein expression plasmid (or control) using Lipofectamine 2000 (Invitrogen, following manufacturer’s instructions) and plated in 6-well plates ...
-
bioRxiv - Genetics 2019Quote: ... SDS-Page separation was completed by running 2 μg of total protein on a NuPAGE™ 3-8% Tris-Acetate gel (Thermo Fisher Scientific). Next ...
-
bioRxiv - Biochemistry 2021Quote: Hsc70cb cDNA was amplified using PCR and inserted into the pProEX-HTA protein expression vector using 5’ SacI and 3’ SpeI restriction enzyme sites (Invitrogen, Carlsbad, CA, USA). Two Drosophila NBD constructs (with or without a stop codon ...