Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and RT-qPCR was performed using SYBR® Green Real-Time PCR Master Mixes (Invitrogen™) and the StepOnePlus Real System (Applied Biosystems™) ...
-
bioRxiv - Neuroscience 2019Quote: ... RT-qPCR reactions were run on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems) with the following conditions ...
-
bioRxiv - Genomics 2021Quote: ... RT-qPCR was performed using an ABI 7500 Real-Time PCR system (Applied Biosystems, CA, USA) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCRs were run in a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH (GAPDH FWD 5’-3’= GTTCGACAGTCAGCCGCATC ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was quantified by RT-qPCR on a StepOnePlus Real-Time PCR System (Applied Biosystems) using TaqMan Fast Virus 1-Step Master Mix chemistry (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The RT-qPCR reaction was also performed using the StepOne real-time PCR system (Applied Biosystems) with the KOD SYBR qPCR Mix (Toyobo Co ...
-
bioRxiv - Plant Biology 2021Quote: ... The RT-qPCR were performed in the QuantStudio® 3 Real-Time PCR System (Applied Biosystems) using the SYBR® Green detection system ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real-time RT-PCR was performed in a StepOne plus system (ABI StepOne Plus, ThermoFisher, USA) using SYBR green master mix (cat ...
-
bioRxiv - Genomics 2021Quote: ... SARS-CoV-2 RT-qPCR was performed in a 7500 Real-Time PCR System (Applied Biosystems) using Seegene-Allplex 2019-nCoV Assay ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time RT-PCR was conducted with TaqPath 1-Step Multiplex Master Mix (ThermoFisher Scientific, USA) and total RNA isolated by TRIzol LS reagent from individual oral swabs and feces samples.
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed on the 7500 Fast or StepOnePlus Real-Time PCR System (Thermo Fisher), following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT-qPCR was carried out using a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) and KAPA SYBR Fast qPCR reagents (KAPA Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR was run in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific 4453545) with cycle settings following manufacturer’s protocols for the RT-qPCR kit ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR reactions were performed on the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) using SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: RT-qPCR was performed with a StepOnePlus™ Real-Time PCR System (ThermoFisher Scientific, Waltham, MA). Forward and reverse primers ...
-
bioRxiv - Immunology 2023Quote: ... real-time quantitative PCR (RT-qPCR) was performed using TaqMan Fast Advanced Master Mix (Applied Biosystems) and the following primers which were all purchased from Applied Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: RT-qPCR was performed in a QuantStudioTM 5 Real-Time PCR System (Applied Biosystems, Massachusetts, USA). Genes were amplified employing the AceQ® qPCR SYBR Green Master Mix (NeoBiotech ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was performed in a QuantStudioTM 5 Real-Time PCR System (Applied Biosystems, Massachusetts, USA). Genes were amplified employing the AceQ ® qPCR SYBR Green Master Mix (NeoBiotech ...
-
bioRxiv - Pathology 2023Quote: ... RT-qPCR reactions were conducted on the Viia 7 Real-time PCR System (Applied Biosystems, USA) with SYBR Premix Ex TaqTM II (TaKaRa ...
-
bioRxiv - Immunology 2024Quote: ... RT-qPCR was performed using a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher Scientific) per manufacturer methods and as previously published49 ...
-
bioRxiv - Microbiology 2024Quote: ... RT-qPCR reactions were performed on QuantStudio 12 K Flex Real-Time PCR System (Applied Biosystems) and analyzed with the QuantStudio 12 K Flex Applied Biosystems software v1.2.3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative real-time RT-PCRs were performed in a QuantStudio 7 Flex System (Thermo Fisher Scientific) using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... one-step RT-qPCR was performed using a QuantStudio 3 Real-Time PCR System (Applied Biosystems) using the Luna Universal One-Step RT-qPCR Kit (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time PCRs were performed using the AB quantitative real-time PCR system ViiA 7 (Applied Biosystems). Fast SYBR Green master mix (Life ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time PCR reactions were run on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Immunology 2019Quote: ... Library concentrations were determined by real-time PCR with a StepOnePlus Real Time PCR System (Thermo Fisher) and a Kapa Library Quantification Kit (Kapa Biosystems / Roche) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and quantitative real-time PCR (qPCR) was performed on the StepOne Real-Time PCR System (Applied Biosystems). Human GAPDH abundance was used for normalization ...
-
bioRxiv - Immunology 2019Quote: ... Real time PCR analysis was performed using StepOne and QuantStudio 5 Real-Time PCR systems (Applied Biosystems). Hprt ...
-
bioRxiv - Genetics 2019Quote: ... SYBR green real-time PCR cycling conditions using QuantStudio 6 Flex Real-Time PCR system (ThermoFisher Scientific) and amplification efficiency calculation (E=e(−1/slope) ...
-
bioRxiv - Microbiology 2021Quote: ... mRNA was quantified by real-time PCR using a ViiA 7 Real-Time PCR System (Life Technologies), fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was performed on Applied Biosystems QuantStudio 3 Real-Time PCR System (Thermo Fisher) using SYBR® Green JumpStart™ Taq ReadyMix™ (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... and 60°C for 1 min with real-time PCR system (StepOnePlus Real-Time PCR System, ThermoFisher). In the assay ...
-
bioRxiv - Neuroscience 2020Quote: ... Quantitative real-time PCR was performed with the Step One Plus Real-Time PCR System (Applied Biosystems), using iTaq SYBR Green Supermix with ROX(Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR was performed on a real-time PCR system (QuantStudio 6 Flex, Applied Biosystems) with Power SYBR Green RNA-to-CT 1-Step Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCR was performed on a real-time PCR system (QuantStudio 6 Flex, Applied Biosystems) with SYBR Green PCR Master Mix (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA yield was assessed using real-time PCR (7500 Fast Real-Time PCR; Life Technologies, Poland). cDNA was amplified in a reaction mixture containing 1 × qPCR Master Mix (A&A Biotechnology ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was completed on a real-time PCR instrument (7500 Fast Real-Time PCR System, Applied Biosystems) with the Applied BiosystemsTM PowerUPTM SYBRTM Green Master Mix from Applied Biosystems using primers P11 and P12 (Table S1).
-
bioRxiv - Biochemistry 2022Quote: ... Real-time PCR was carried out on the QuantStudio 6-flex Real-time PCR System (ThermoFisher Scientific) using SYBR Green FastMix (QuantaBio ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative real-time PCR analysis was performed in a QuantStudio 5 Real-Time PCR System (Applied Biosystems). Primers and TaqMan probes were as follows ...
-
bioRxiv - Genetics 2022Quote: ... Real-time PCR was performed using the StepOne Real-Time PCR system (Thermo Fisher Scientific Inc., USA) and KAPA SYBR FAST qPCR Master Mix (2X ...
-
bioRxiv - Immunology 2022Quote: ... The real-time PCR was performed on QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Reactions were performed in duplicates in a final reaction volume of 20 µL containing 10 µL of Power SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real-time PCR analysis was performed utilizing the ViiA7 Fast Real-Time PCR System (Applied Biosystems). The ISG ...
-
bioRxiv - Physiology 2022Quote: ... Real-time PCR was performed with SYBR green using an ABI7300 Real time PCR Instrument (Applied Biosystems), with 3 biological replicates ...
-
bioRxiv - Biochemistry 2019Quote: ... Taqman qPCR master mix with no amperase UNG was obtained from Life Technologies and quantitative real-time PCR was performed using an ABI-7900 real-time PCR system (Life Technologies).
-
bioRxiv - Microbiology 2019Quote: ... SYBR Green Real-Time PCR was performed on a StepOnePlus Real-Time PCR System (Thermo Scientific, USA) using SSO Advanced SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... Real time quantitative PCR (qPCR) was performed using a 7500 Fast Real-Time PCR System (Applied Biosystems). PerfeCTa® SYBR® Green FastMix was used ...
-
bioRxiv - Physiology 2021Quote: ... Quantitative real-time PCR was performed in ViiA7 and QuantStudio 6 real-time PCR systems (Applied Biosystems) using the SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2020Quote: ... The real-time PCR was performed on QuantStudio™ 7 Flex Real-Time PCR System (Thermo Fisher). Reactions were performed in triplicates in a final reaction volume of 10 μl containing 5 μl of iQ™ SYBR® Green Supermix (Biorad ...
-
bioRxiv - Molecular Biology 2019Quote: ... Real time PCR step quantification was performed on ViiA 7 real time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2021Quote: ... Real-time PCR was performed with SYBR green using an ABI7300 Real time PCR Instrument (Applied Biosystems). Expression of the various genes was determined by the comparative CT method (ABI Prism 7700 Sequence Detection System User Bulletin #2 ...