Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for bta mir 486 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... RT-PCR was performed with 100 ng of total RNA using SuperScript III One-Step RT-PCR System (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA from blood and tissue samples from NPs were used for RT-PCR amplification using SuperScript™ IV One-Step RT-PCR System kit (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... RT-PCR assays were performed using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (ThermoFisher Scientific) following manufacturer’s conditions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), or 100 nM FlexiTube siRNA to ARF6 (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 nM Anti-miR miRNA Inhibitor to hsa-miR-218-5p (Ambion, Inc., Austin, TX), or 100 nM FlexiTube siRNA to ARF6 (Qiagen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Quantitative real-time Primer sample sets for TaqMan amplifications were obtained from Life Technologies (Darmstadt, Germany). Here ...
-
bioRxiv - Microbiology 2021Quote: ... Delta-delta CQ was calculated using the 18S ribosomal RNA primer/probe set (4331182; Thermo Fisher). Virus RNA (vRNA ...
-
bioRxiv - Bioengineering 2021Quote: ... We prepared LAMP primer mix and probe set mix stocks in nuclease-free water (Thermo Fisher) and stored at -20 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1μL cDNA template with 0.5μL premade primer sets (SOS1: 4331182 Hs00893128_m1, SOS2: 4331182 Hs01127273_m1, GAPDH: 4331182 Hs03929097_g1; Thermo Scientific). This was followed by Amplitaq activation at 50°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... water and primers to set up a standard qPCR run on the QuantStudio instrument (Applied Biosystems). For the transcription factor induction experiments using the transduced cell-lines ...
-
bioRxiv - Molecular Biology 2023Quote: ... LOX-4 (Mm 00446385_m1) and 18S ribosomal RNA primer/probe set (Hs 03003631; Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2024Quote: ... and PCR amplified with barcoded primers using Phire Plant Direct PCR Mix (ThermoFisher). The PCR amplicons were purified and pooled for NGS ...
-
bioRxiv - Immunology 2020Quote: ... and RNA was hybridized first using RT primer (/5BiosG/AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TVN) then reverse-transcribed into cDNA using TSO primer (AAGCAGTGGTATCAAC-GCAGAGTACATrGrGrG) and RT maxima reverse transcriptase (Thermo Scientific). cDNA was amplified using ISPCR primer (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Plant Biology 2022Quote: ... The PCR program was set on a StepOne™ Real-Time PCR Machine (Applied Biosystems, UK) as follows ...
-
bioRxiv - Immunology 2021Quote: Reactions for qRT-PCR were set up using the One-Step qRT-PCR Kit (Thermo Fisher SuperScript III Platinum ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were then set up using Power SYBR Green PCR Master Mix (Invitrogen, Cat #: 4367659), 1 μl of cDNA and 0.2 μM primers (Table S5) ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed with AgPath-ID One-Step RT-PCR reagents (Thermo Fisher Scientific), panRusV-2 primers (final concentration ...
-
bioRxiv - Genomics 2022Quote: RNA was reverse transcribed for 20 min at 54°C with 1.5 µL RT primer and 10 µl RT mix (0.6 µl Superscript III (Thermo Fisher cat# EP1756B012), 2.17x SuperScript III RT buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... Methylated RNA species were recovered from the elution and reverse transcribed (RT) using the RT primer and SuperScript III (Invitrogen 18080044). Excessive RT primer was digested with ExoSAP-IT (Applied Biosystems 78250) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Primers for qRT-PCR were purchased from Life Technologies: Arg1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Custom PCR primers (DNA) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was reaction mixture was set up using TaqMan Fast Advanced Master Mix (Thermo Fisher) and Taqman probes for POLDIP2 (Hs00210257_m1 ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative reverse transcription-PCR (qRT-PCR) was performed using the StepOnePlus RT-PCR system (Applied Biosystems) and the 5x HOT FIREPol® EvaGreen® qPCR Supermix kit from Solis BioDyne ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-Time PCR was performed for miR-4521 expression analysis using miRNA Taqman assay (Applied Biosystems, USA) and gene expression analysis using PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2023Quote: ... specific mRNA or miR-143/145 was amplified using Power SYBR Green PCR Master Mix (Applied Biosystems) or Taqman Universal PCR Master Mix ...
-
bioRxiv - Plant Biology 2019Quote: ... Quantitative RT-PCR was carried out using a PCR system (StepOne; Applied Biosystems) and the Luna One-Step RT-qPCR Kit (NEB ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... CD33m was amplified by PCR using SuperScript III One-Step RT-PCR (Invitrogen) and Gene-specific primers 5’-TTATATGCTAGCGCCACCATGCCGCTGCTGCTACTGCTGC-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: ... RT-qPCR PCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) using primers listed in Table 1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT–PCR was done using SYBR Green PCR Master Mix (Applied Biosystems, 4309155) on a ViiA 7 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR was performed on StepOne® Realtime PCR system (Applied Biosystems) using KAPA SYBR FAST qPCR Kits (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-PCR was performed on a 7500 Real-Time PCR System (Applied Biosystems) using the iTaq Universal SYBR Green Supermix (BioRad) ...
-
bioRxiv - Immunology 2022Quote: ... followed by RT-PCR with Fast SYBR Green PCR Master Mix (Applied Biosystems) in QuantStudio3 (Applied Bioscience) ...
-
bioRxiv - Physiology 2021Quote: ... Real-time PCR (RT-PCR) was performed on a Quantstudio 3 (ThermoFisher Scientific) using Taqman Fast Advanced Master mix (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR was performed using one step SuperScriptR RT-PCR kit (Invitrogen, Carlsbad, CA) with E7 specific primers ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-PCR was performed using Dream-Taq Green PCR master mix (Thermo Fisher). The RT-PCR was performed to validate the expression of full-length Cas12f and tracrRNA-crRNA in the plant ...
-
bioRxiv - Physiology 2022Quote: ... Real-time PCR (RT-PCR) was performed on a Quantstudio 3 (ThermoFisher Scientific) using GoTaq qPCR Master Mix (Promega ...
-
bioRxiv - Physiology 2023Quote: ... Real-time PCR (RT-PCR) was performed on a Quantstudio 3 (ThermoFisher Scientific) using Luna Universal qPCR master mix for Sybr Green primers (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time PCR was carried out using Sybr Green RT-PCR kits (Invitrogen) on a 7900HT fast real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Physiology 2023Quote: ... Real-time PCR (RT-PCR) was performed on a Quantstudio 3 (ThermoFisher Scientific) using either Luna Universal qPCR master mix for Sybr Green primers (New England Biolabs ...
-
bioRxiv - Systems Biology 2021Quote: The V1–V2 region of 16S rRNA was amplified by RT-PCR using the primers PGM- 27F (CCATCTCATCCCTGCGTGTCTCCGACTCAG-[MID]- GATAGAGTTTGATCMTGGCTCAG) and PGM-338R (CCTCTCTATGGGCAGTCGGTGATTGCTGCCTCCCGTAGGAGT) and sequenced using IonPGM (Thermo Fisher Scientific, Waltham, MA, USA) to profile bacterial community structure ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 2 μg of total RNA from each sample was used for reverse transcription-polymerase chain reaction (RT-PCR) with random hexamer primers (Invitrogen, Waltham, MA, USA; Cat#58875). SYBR® Green (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... amplicons were produced with primers (WU-21-F: AATCTATCAGGCCGGTAGCAC; WU-86-R: CAACAGCTATTCCAGTTAAAGCAC) using SuperScript IV One-step RT-PCR (Thermo Fisher Scientific; Waltham, MA USA). Amplicons were sequenced on a MinION system using from Oxford Nanopore using Native Barcoding 1-12 (EXP-NBD104 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and quantitative RT-PCR was performed using gene-specific primers (see Supplemental Table S2 for details) and SYBR Green master mix (Thermo Fisher Scientific, Waltham, MA, USA). Negative delta cycle threshold (-Δ Ct ...
-
bioRxiv - Bioengineering 2023Quote: ... reverse transcription employed the ThermoFisher TaqMan MicroRNA Reverse Transcription Kit with miR-specific primers and probes (Thermo Fisher Scientific, Waltham, MA, USA), and proceeded according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... 100 ng of RNA and miR specific primers were used for cDNA synthesis using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems, 4366597). MiR-541-3p levels were quantified using the Ct method after normalization with RNU44 or U6 and are presented as arbitrary units.
-
bioRxiv - Microbiology 2019Quote: ... The reaction was monitored at 486 nm using a Multiskan Go plate reader (Thermo Scientific).
-
bioRxiv - Microbiology 2021Quote: ... 200 pM 515F primer and 200 pM barcoded 806R primer (IDT) in PCR-clean water (Invitrogen Ultra Pure DNase/RNase-Free Distilled water) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic PCR primers were designed using the Primer-BLAST tool (80) and ordered from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... TaqMan real-time RT-PCR was conducted using AgPath-ID™ One-step RT-PCR Reagents (Applied Biosystems, Foster City, CA, USA) and performed on an Mx3000P QPCR System (Stratagene ...
-
bioRxiv - Neuroscience 2020Quote: ... The viral RNA loads were determined by real time RT-PCR with the Taqman one-step RT-PCR master kit (Applied Biosystems, CA). The following specific primers and probe of NCSU1 FIV gag region were used ...