Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for bmp2b Antibody FITC since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... POS were labelled with 2.5 mg/ml FITC dye (Thermo Fisher, F1906), resuspended in DMEM (Thermo Fisher ...
-
bioRxiv - Immunology 2021Quote: FOXP3 Ab conjugated to APC or FITC (clone FJK-16s) manufactured by Invitrogen, purchased from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and a FITC-conjugated goat anti-mouse (1:200; Invitrogen; catalogue number F2761). All antibody dilutions were made in TBS containing 15 % normal goat serum (Millipore) ...
-
bioRxiv - Neuroscience 2022Quote: ... muscles were incubated with FITC rabbit anti-mouse IgG1 (1:400, Invitrogen A21121) and Alexa fluoro-568 conjugated α-bungarotoxin (1;500 ...
-
bioRxiv - Zoology 2022Quote: ... aggregates were incubated with phalloidin (1:50) conjugated with FITC (Molecular Probes, Invitrogen) for 1h at room temperature ...
-
bioRxiv - Zoology 2022Quote: ... aggregates were incubated with phalloidin (1:50) conjugated with FITC (Molecular Probes, Invitrogen) for 1h at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... muscles were incubated with FITC rabbit anti-mouse IgG (Invitrogen A21121, 1/400) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... For staining of F-actin embryos were incubated with Phalloidin-FITC/TRITC (Invitrogen).
-
bioRxiv - Microbiology 2019Quote: ... the cells were treated with 5 mg/ml FITC dextran (MW 40,000, ThermoFisher) for 30 min at 37 °C to target macropinosomes ...
-
bioRxiv - Immunology 2020Quote: ... and stained with either anti-FoxP3-FITC (Thermo Fisher, FJK-16s, 1:100) or the isotype control (Invitrogen ...
-
bioRxiv - Neuroscience 2019Quote: ... and the fluorescence marker (1:1000; rabbit anti-FITC, ThermoFisher Cat No. 11090) were diluted in blocking solution and the slices incubated with them for at least 24 hours at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... FITC anti-mouse B220 (eBioscience) and Near-IR Fixable LIVE/DEAD dye (Thermofisher). Cells were washed and analyzed by flow cytometry (BD LSR-II ...
-
bioRxiv - Microbiology 2019Quote: ... Fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Invitrogen, 1:500 in PBST) was used as the secondary antibody ...
-
bioRxiv - Microbiology 2021Quote: ... and intracellular staining of anti-human Arginase1 FITC (Ref: 53-3697-82, Thermofisher). Cell surface markers were stained directly while intracellular staining required additional processing using a cell fixation and permeabilization kit as described above (eBiosciences FOXp3/Transcription factor staining buffer set ...
-
bioRxiv - Microbiology 2021Quote: ... then cells were incubated with anti-avidin-FITC (500 ng/mL, Invitrogen, A821) which was diluted in permeabilized buffer (1% FBS and 0.2% Triton X-100 in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with anti-mouse FITC (dilution 1:1000, Thermo Fisher Scientific) and anti-rabbit AF647 (dilution 1:1000 ...
-
bioRxiv - Neuroscience 2022Quote: ... muscles were incubated with FITC rabbit anti-mouse IgG (Invitrogen A21121, 1/400) overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... FITC-labelled sambucus nigra lectin (10 μg/mL, Thermo Fisher Scientific, 60 min), or mouse IgG1 specific to the ISAV hemagglutinin esterase (clone 3H6F8 [52] ...
-
bioRxiv - Cancer Biology 2023Quote: Apoptosis was assessed via the FITC-conjugated Annexin V Apoptosis Detection Kit (ThermoFisher) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... CD45 staining with a rat anti-mouse CD45 conjugated to FITC (Invitrogen; MCD4501) was used to eliminate any mouse blood cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... then incubated with goat anti-mouse IgG-FITC (Thermo Scientific cat# F-2761) diluted 1:1000 in 3% BSA-PBS for 1 hour at RT ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The other fraction was used to stain with anti-CD45 (FITC, Thermo Fisher) and anti-EpCAM (PE-Texas Red ...
-
bioRxiv - Cancer Biology 2023Quote: ... an equal volume of 0.04 mg/mL FITC-casein (Thermo Scientific™, 23267), 4 mM ATP (Thermo Fisher ...
-
bioRxiv - Bioengineering 2023Quote: ... and fluorescein-5-isothiocyanate (FITC) was purchased from Fisher Scientific (Waltham, MA, USA). 1,10-Dioctadecyl-3,3,30,30-tetramethylindotricarbocyanine iodide (DiR ...
-
bioRxiv - Molecular Biology 2024Quote: ... FITC anti-mouse MHC II (Invitrogen, Cat# 11-5321-82, Clone M5/114.15.2), and PE anti-mouse CD207 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were washed with PBS and incubated with Annexin V-FITC (ThermoFisher Scientific) in Binding Buffer (10 mM HEPES pH 7.4 ...
-
bioRxiv - Biophysics 2023Quote: ... Biotinylated fluoresceine isothiocyanate (b-FITC; 732.8 Da) was purchased from Thermo Scientific (# 10752905). A tandem repeat of the Z domain of protein A connected through a flexible spacer (12 amino acids ...
-
bioRxiv - Molecular Biology 2020Quote: ... Pre-warmed coating solution composed of 0.1 mg/ml FITC-gelatin (#G-13187, Invitrogen) and 10 μg/ml laminin (#23017-015 ...
-
bioRxiv - Biophysics 2020Quote: ... were incubated for 2h together with phalloidin-FITC (Molecular Probes Inc, Eugene, OR, USA). Coverslips were mounted on microscopy slides and visualized with a HC PL APO 63x/1.40 Oil CS objective lens attached to a Leica TCS-SP5 II confocal microscope (Leica Microsystems ...
-
bioRxiv - Immunology 2019Quote: ... anti-human CD3 conjugated to FITC (clone OKT3, cat. no. 11-0037-41, Invitrogen), anti-human CD8 conjugated to Pacific Blue (clone 3B5 ...
-
bioRxiv - Biochemistry 2020Quote: ... Wells without FITC-rhPRG4 were probed with anti PRG4 Ab LPN (1:500, Invitrogen) in blocking solution overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with streptavidin fluorescein (FITC) conjugated (1:400) (Thermo Fisher Scientific, Canada) on a shaker at 4°C for 12 hours ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... FITC conjugated F(ab’)2 goat anti-human IgA (Thermo Fisher Scientific, Illkirch, France), Brilliant Violet 650 conjugated streptavidin (BioLegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... then analyzed for viability using the FITC Annexin V Apoptosis Detection Kit (Thermo Scientific). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... The biotinylated whole-cell lysate was then added to FITC neutravidin beads (ThermoFisher, F8776) at a ratio of 5µg antigen:1µL beads ...
-
bioRxiv - Immunology 2019Quote: ... Biotinylated proteins were coupled to FITC-labeled 1um FluoSpheres NeutrAvidin-labeled Microspheres (Thermo Fisher) at 1 ug to 1 ul ratio of protein to beads for 2 hours at 37°C ...
-
bioRxiv - Physiology 2019Quote: ... we intravenously injected 70-kDa-dextran-FITC (50 μl of 2.5 mg/ml; Invitrogen) followed by injection of inactive Exendin-4 (E9)-Cy3 (50μl ...
-
bioRxiv - Physiology 2019Quote: ... cells were further incubated with Streptavidin-FITC conjugate (1:1000, Thermo Fisher Scientific, USA) at room temperature for 1 hour.
-
bioRxiv - Developmental Biology 2020Quote: ... Probes labeled with biotin-16-dUTP were detected using avidin-FITC conjugate (Fisher Scientific) and probes labeled with digoxigenin-11-dUTP were detected using anti-digoxigenin rhodamine (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... The concentration of a FITC-labeled repebody was measured by NanoDrop 2000c (Thermo Scientific). For confocal microscopy ...
-
bioRxiv - Immunology 2021Quote: ... cells from spleen and liver were stained with Annexin V-FITC (V13242 from Invitrogen) and LIVE/DEAD Near IR (L34976 from Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... Apoptosis was measured using the FITC Annexin V/Dead Cell Apoptosis Kit (Invitrogen, V13242). For cell cycle analysis ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cells were incubated with 0.5 μm FITC-labeled microspheres (F8813, Thermo Fisher, Waltham, MA) at a concentration of 5 × 108 microspheres/ml for 1 h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: Cells were stained with calcofluor and FITC-conjugated wheat germ agglutinin (WGA: Molecular Probes) to visualize chitin ...
-
bioRxiv - Microbiology 2022Quote: ... stained using FITC-conjugated F(ab’)2-Goat anti-human IgA (Invitrogen; 1/1000) in PBS + 0.1% BSA for 20 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... hMSCsshCtl and hMSCsshSTC1 were isolated and stained with annexin V-FITC and PI (Invitrogen), then apoptosis-positive cells were analyzed using FACS (Millipore Muse).
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg mL-1 10,000 MW FITC lysine charged dextran (ThermoFisher Scientific, Waltham, MA) and 50 ng µL-1 of Renilla Luciferase (RLuc ...
-
bioRxiv - Cancer Biology 2022Quote: ... samples were washed and stained for CD11b conjugated to FITC (#11-0118-42, Thermofisher), then fixed and analysed on the BD LSR II ...
-
bioRxiv - Microbiology 2023Quote: ... then washed and stained with FITC-annexin V and propidium iodide (PI; ThermoFisher Scientific) to detect dead and dying cells ...