Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Zika Virus NS1 Protein Suriname Strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Antibodies used: anti-Influenza A virus NS1 (PA5-32243, ThermoFisher), anti-acetyl-α-tubulin (Ly640 ...
-
bioRxiv - Microbiology 2024Quote: ... NS1 proteins were detected using DENV2 NS1 polyclonal antibody (1:1,000 ThermoFisher Scientific) with overnight incubation at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: Zika virus RNA yields were assessed using real-time PCR on a 7500 Fast Real-Time PCR instrument (Thermo Scientific, Poland). ZIKV cDNA was amplified in a reaction mixture containing 1× TaqMan Universal PCR Master Mix (RT-PCR mix ...
-
bioRxiv - Immunology 2023Quote: ... and H1N1/2009 influenza virus strains were prepared by overnight incubation of the virus strains with 0.1% v/v β propiolactone (Acros Organics, Geel, Belgium) under continuous rotation at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... NS1 (Invitrogen Cat #PIPA532243, 1:1000), NP (BioRad Cat#MCA400 ...
-
bioRxiv - Microbiology 2021Quote: ... were transfected with pcineo plasmids (0.4 μg) carrying the RSV codon-optimised NS1 or FLAG-NS1 WT or mutant constructs using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Immunostaining of NS1 and TRIM25 was realized by using the following antibody combination: mouse anti-NS1/goat anti-mouse Alexa 488 (ThermoFisher Scientific) and rabbit anti-TRIM25 (abcam)/goat anti-rabbit Atto647N (sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... coli (K-12 strain), and Staphylococcus aureus (Wood strain, without protein A) (Molecular Probes), were washed 3 times with PBS by centrifugation and sonicated for 3 times at 50 KHz for 20 s ...
-
bioRxiv - Immunology 2020Quote: ... aureus bioparticles (Wood strain without protein A) (Thermofisher) were resuspended in PBS with 2 mM sodium azide and 4–20×106 bioparticles were injected directly into tumors ...
-
bioRxiv - Microbiology 2023Quote: ... anti-NS1 and anti-NS2 (all 1:2000, Thermo Fisher). Membranes were washed in PBS-T and incubated with fluorescent secondary antibody (anti-mouse or anti-rabbit conjugated to AlexaFluor488 or 647 ...
-
bioRxiv - Microbiology 2023Quote: ... Presence of each virus strain in the supernatant was determined by PCR using Taq polymerase (Thermo Scientific) and 20 μL reactions containing 1 μL of virus supernatant ...
-
bioRxiv - Synthetic Biology 2020Quote: Proteins were expressed from E.coli BL21-AI strains (Invitrogen) carrying appropriate plasmids for expression of E.coli Gnd or E.coli RpiA (ribose-5-phosphate isomerase ...
-
bioRxiv - Molecular Biology 2023Quote: ... BL21(DE3) protein expression strain was obtained from Thermo Fisher Scientific.
-
bioRxiv - Microbiology 2022Quote: ... and the concentration of total virus proteins were determined by a BCA protein assay kit (Thermo Fisher) (31 ...
-
bioRxiv - Microbiology 2023Quote: Influenza A virus (IAV) strain A/WSN/33 [H1N1 subtype] was propagated in Madin-Darby Canine Kidney (MDCK) cells (ThermoFisher). Cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Immunology 2023Quote: ... The recombinant NS1 gene was cloned into the pTRC–His2c expression vector (Invitrogen) and expressed in the BirA-enzyme containing E ...
-
bioRxiv - Immunology 2022Quote: ... or mouse anti-Hepatitis C virus Core protein (clone C7-50, Life Technologies) were visualised using IRDye 800CW Donkey anti-Rabbit IgG or Goat anti-Mouse IgG (LiCor) ...
-
bioRxiv - Microbiology 2020Quote: SADS-CoV spike glycoprotein (virus strain GDS04; GenBank No.: ASK51717.1) gene was synthesized with codons optimized and inserted into pFastBac vector (Life Technologies Inc.). The ectodomain of SADS-CoV spike protein without the transmembrane anchor and intracellular tail (residues 18-1068 ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration of the purified virus preparations was determined using a BCA protein assay kit (Thermo Fisher Scientific) prior to the addition of lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding RSV NS1 was cloned by in vitro recombination (Gateway technology; Invitrogen) from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD) ...
-
bioRxiv - Biophysics 2023Quote: For protein expression and purification experiments we employed the commonly used protein expression strains BL21(DE3) (ThermoFisher Scientific) 20 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We used strain YDL185W from the green fluorescent protein (GFP) clone collection (Invitrogen), which expresses Vma1p-GFP fusion protein [30] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were expressed in Escherichia coli strain BL21(DE3)pLysS (Thermo Fisher Scientific). 1-4 liters of cells were grown in Luria-Bertani (LB ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins from virus-infected cells were immunoprecipitated using protein G magnetic Dynabeads according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: ... coli strain (ATCC 11303 strain, 14380, Affymetrix) were used.
-
bioRxiv - Immunology 2019Quote: ... Unlabeled Staphylococcus aureus (Wood strain without protein A) BioParticles were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: For protein purification Escherichia coli strains were tested for optimal expression: BL21 DE3 (Thermofisher) was selected for PpMurE_L63_pPROEX and BL21(DE3) ...
-
bioRxiv - Microbiology 2019Quote: ... Strains used for cloning and expression of recombinant proteins were Escherichia coli TOP10 (Invitrogen) and E ...
-
bioRxiv - Immunology 2023Quote: ... Media containing virus particles was first concentrated to 20x using 100K MWCO protein concentrator columns (Thermofisher). Concentrated virus was then incubated using 1:2000 DiD-Cell labelling solution (ThermoFisher V22887 ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-NS1 antibody binding was detected by a biotinylated goat anti-mouse IgG secondary antibody solution (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... coli strains DH5α and DH10B strains (both from Invitrogen) were used for molecular cloning ...
-
bioRxiv - Microbiology 2021Quote: ... Porcine reproductive and respiratory syndrome virus [PRRSV] European and North American strains (LSI VetMAX™ PRRSV EU/NA Real-Time PCR Kit; Thermo Fisher Scientific, MA, USA), Swine influenza virus [SIV] (EXOone Influenza A ...
-
bioRxiv - Microbiology 2021Quote: Vero81 cells were adsorbed with CHIKV strains diluted in virus dilution buffer (VDB, RPMI medium with 25 mM HEPES [Gibco] supplemented to contain 1% FBS) at a multiplicity of infection of 0.01 plaque-forming units (PFU)/cell at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Strains with GFP-labeled endogenous proteins were from the yeast GFP clone collection (ThermoFisher Scientific) (52) ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli strain (Thermofisher), and purified using a Plasmid DNA Gigaprep kit (Zymo) ...
-
bioRxiv - Biochemistry 2024Quote: ... coli strain (ThermoFisher), blue-white colony screen was performed ...
-
bioRxiv - Microbiology 2024Quote: ... coli strain (Invitrogen) was used for cloning and routinely grown at 37°C (30°C for protein production ...
-
bioRxiv - Developmental Biology 2022Quote: Mouse zygotes (C57BL6/N strain) were injected with 200 ng/µL Cas9 protein (IDT and ThermoFisher), 100 ng/µL Fzd2-specific sgRNA (GCAAGACACTGCACTCGTGG) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse zygotes (C57BL/6N strain) were injected with 200 ng/μl CAS9 protein (IDT and ThermoFisher), 100 ng/μl Tgfbr2-specific sgRNA (AGGTCAAGTCGTTCTTCACT) ...
-
bioRxiv - Cell Biology 2023Quote: ... BacMam 2.0 virus (Invitrogen, C10593).
-
bioRxiv - Microbiology 2019Quote: ... The purified virus was quantified using the bicinchoninic acid (BCA) protein assay kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... Loss of virus was monitored by staining with anti-Sendai virus antibody (Invitrogen, cat #14649482).
-
bioRxiv - Synthetic Biology 2021Quote: All yeast strains were derived from parental strains Fy251 [American Type Culture Collection (ATCC) 96098] or the two-hybrid strain MaV20330 (Invitrogen). Yeast transformations were carried out using the lithium acetate method48 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Protein A-tagged strains were immunoprecipitated with Rabbit IgG-conjugated (MP-Biomedicals, SKU 085594) Dynabeads (Invitrogen, 14301) (Vakiloroayaei et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... Virus was diluted in sterile 0.9% w/v sodium chloride in low protein binding collection tubes (Life Technologies Ltd) and stored at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... using strains DH5α (Invitrogen), NEB10β (New England Biolabs) ...
-
bioRxiv - Neuroscience 2019Quote: ... coli strain (ThermoFisher, USA) to avoid ITR-mediated recombination ...
-
bioRxiv - Biophysics 2019Quote: ... coli strain TOP10 (Invitrogen) was used as the host strain for all plasmids ...
-
bioRxiv - Cancer Biology 2019Quote: ... coli strain (Thermo Fisher). Lentiviral particles were synthetized through transfection of 20µg of CAS9 expression vector ...
-
bioRxiv - Biophysics 2020Quote: ... coli strain Top10 (Invitrogen). Cells were grown in 4L flasks at 37°C in LB media supplemented with 100 mg/mL ampicillin to an OD600 of 0.5 ...