Labshake search
Citations for Thermo Fisher :
1 - 50 of 919 citations for Universal TT epitope P2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... or TT injected (exogenous) sFKN peptide (Invitrogen, cat. #EMCX3CL1) was estimated from 50 µg of cochlear protein lysate by following the manufacture’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... AMA1 and TT were biotinylated with the Sulfo-NHS-LC-Biotinylation Kit (ThermoFisher) at a ratio of 1:1 according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... P2 rat primary cortical astrocytes (Thermo Scientific, N7745100) at 25k/well were added to the same vial ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-V5 epitope (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2019Quote: TT’s were visualized by staining with di-4-ANEPPS (4 µmol/l. Invitrogen, UK) as described in detail previously 8,32,70 ...
-
bioRxiv - Systems Biology 2023Quote: ... 1% PFA PT and TT were then purified using Zeba spin desalting columns (ThermoFisher). The antigens were coupled with each unique conjugated microsphere using the xMAP Antibody Coupling Kit (Luminex Corporation) ...
-
bioRxiv - Immunology 2023Quote: ... NC and TT were aspecifically biotinylated using EZ-Link Sulfo-NHS-LC-Biotinylation Kit (Thermo Fisher) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: ... slides were washed with PBS-TT before incubating with secondary antibodies (goat anti-rabbit 488 (ThermoFisher) 1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... the DYKDDDK epitope (FLAG; ThermoFisher, RRID: AB_2536846) 1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... was amplified with BKMP185-186 and introduced into pDonorP5-P2 (Invitrogen) to generate pMME1540 ...
-
bioRxiv - Bioengineering 2022Quote: ... P1 (ATGTGGGCTGCCTAGAAAGG) and P2 (TTGGACATGAGCCAATATAAATG) using Phusion DNA polymerase (Thermo Fisher). The positive band from genotyping PCR was subjected to Sanger sequencing.
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-SST (Thermo Fisher PA5-85759, only used at P2). Secondary antibodies (used at 1:300 dilution ...
-
bioRxiv - Immunology 2019Quote: ... The full length and truncation sequences were transferred into a Gateway compatible destination vector that includes an N terminal triple-epitope tag (S protein tag, FLAG epitope tag and Streptavidin-binding peptide tag) using the LR clonase enzyme kit (ThermoFisher). Plasmids were transfected into 293T cells using FuGENE transfection reagent (Promega ...
-
bioRxiv - Neuroscience 2020Quote: ... and the DYKDDDK epitope (FLAG; ThermoFisher, RRID: AB_2536846) 1:200.
-
bioRxiv - Developmental Biology 2023Quote: ... ATs and TTs were fixed in 4% PFA and stained with 4′,6- diamidino-2-phenylindole (DAPI) (Invitrogen) to identify cell nuclei ...
-
bioRxiv - Plant Biology 2021Quote: ... and cloned into pDONR 221 P5-P2 using BP Clonase II (Invitrogen). Similarly ...
-
bioRxiv - Cell Biology 2024Quote: ... To detect PI(4,5)P2 a GST Tag Antibody (MA4-004; Invitrogen) was used ...
-
bioRxiv - Genetics 2023Quote: ... and universal nuclease (Pierce Universal Nuclease, Pierce, ThermoFisher Scientific)(83 uL of RIPA ...
-
bioRxiv - Neuroscience 2023Quote: ... HT7 (mid-region [epitope = amino acids 159-163], ThermoFisher), and TauAB (C-terminal [epitope = amino acids 425-441] ...
-
bioRxiv - Cancer Biology 2019Quote: ... Universal Nuclease (ThermoFisher) was used to dechromatinize nuclear DNA for 30 min on ice ...
-
bioRxiv - Biochemistry 2023Quote: ... Universal Nuclease (Thermofisher) was added to lysates before ultracentrifugation at 35,000 rpm for 35min at 4°C ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were co-transfected with 4.5 µg of transposable vector epB-Puro-TT-SYN1-HuD (SYN1::HuD) and 0.5 µg of the piggyBac transposase using the Neon Transfection System (Life Technologies) as described (Garone et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Anti-DYKDDDDK epitope (FLAG) tag (Thermo Scientific Pierce, MA1-91878), Anti-HA (Thermo Scientific Pierce ...
-
bioRxiv - Cell Biology 2019Quote: ... FLAG epitope tag (Mouse mAb; ThermoFisher Scientific [FG4R], MA1-91878), GFP (Rabbit pAb ...
-
bioRxiv - Biophysics 2024Quote: 6x-His epitope tag antibody (His.H8) was purchased from Invitrogen. Monoclonal Flag M2 antibody (F1804-50UG) ...
-
bioRxiv - Neuroscience 2020Quote: ... P2 brains were cut into 10-μm thick coronal cryosections (Cryostar NX50, Thermo Scientific) and mounted on SuperFrost™ Plus glass slides.
-
bioRxiv - Microbiology 2020Quote: ... a custom Ψ-probe was designed for participant P2 (FAM-TGGCGTACTCACCAGG-MGBNFQ, Applied Biosystems) and a custom Ψ-forward primer was designed for participant P3 (CAGGACTCGGCTTGCTGAGC).
-
bioRxiv - Immunology 2024Quote: ... a custom ψ-probe was designed for participant P2 (FAM-TGGCGTACTCACCAGG-MGBNFQ; Applied Biosystems), and a custom ψ-forward primer was designed for participant P2 (CAGGACTCGGCTTGCTGAGC)20 ...
-
bioRxiv - Cell Biology 2020Quote: A TrueGuide crRNA directed against exon 1 of Hs IRS2’s coding region (target DNA sequence: 5’-TCG AGA GCG ATC ACC CGT TT −3’, Assay ID number: CRISPR850215_CR, Thermo Fisher Scientific) was annealed to the TrueGuide tracrRNA (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: To characterize the performance of the lysis heater we fed a single thermocouple (Omega #5TC-TT-TI-36-1M) through a 2 mL centrifuge tube cap (Thermofisher #3471TOS) and threaded onto a 2 mL centrifuge tube (Thermofisher #3490S ...
-
bioRxiv - Cancer Biology 2022Quote: ... and universal nuclease (ThermoFisher). Lysates were cleared of insoluble material by centrifuging at 20,000 g for 10 min at 4°C and protein concentration was determined with the BCA Protein Assay (ThermoFisher) ...
-
bioRxiv - Neuroscience 2023Quote: ... Universal Master Mix (Invitrogen), and 200 nM of forward and reverse primers in a final reaction volume of 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... Golden Gate compatible epitope tag mRuby was synthesized by Thermo Fisher Scientific.
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-c-Myc (9E10) epitope tag monoclonal antibody was from Invitrogen. Benzonase® nuclease was from Novagen (EMD Millipore ...
-
bioRxiv - Microbiology 2023Quote: ... V5 epitope was detected with mouse mAb anti-V5 (#R96025; Invitrogen), and the OLLAS tag was detected using the rat mAb anti-OLLAS.72 The c-Myc epitope was detected with mouse anti-Myc (mAb 9E10 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... PierceTM HA epitope tag antibody beads (Thermo Scientific, Rockford, IL, USA) were used to enrich HA-tagged MOR following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: ... the PCR product was cloned into a pDONR221 P3-P2 using Gateway Technology (ThermoFisher Scientific) according to manufacturer’s manual ...
-
bioRxiv - Cell Biology 2022Quote: ... the Pth1r P2-2 or oligo probe was incubated with streptavidin-coupled Dynabeads (Invitrogen, US) at room temperature for 1 hour to generate probe-bound Dynabeads ...
-
bioRxiv - Cell Biology 2023Quote: ... dec2WT and dec2P384R transgenes were subsequently cloned into the pDONR P5-P2 Gateway vector (Invitrogen) using BP clonase (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... U87-MG cells were first transduced with Tet-On transactivator (rtTA/tTS, VectorBuilder) lentivirus and selected with 200 µg ml−1 hygromycin (#ant-hg-1, Thermo Fisher Scientific) for 14 days ...
-
bioRxiv - Cancer Biology 2021Quote: ... and all other antibodies were also employed against a V5 epitope (Invitrogen), Nrf2 (Abcam) ...
-
bioRxiv - Microbiology 2022Quote: ... monoclonal mouse anti-6x-His antibodies (Epitope-tag-clone: HIS.H8, Thermo Fisher) were employed ...
-
bioRxiv - Cell Biology 2020Quote: Mouse monoclonal anti-V5 epitope tag was purchased from Invitrogen (R960-25). Rabbit anti-LC3B (ab48394 ...
-
bioRxiv - Genetics 2020Quote: ... The epitope was tested using Pierce ECL Western Blotting Substrate (Thermo Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... monoclonal murine antibody directed against the V5 epitope (anti-V5-AP; Invitrogen) of recombinant EmDyp ...
-
bioRxiv - Microbiology 2023Quote: ... The monoclonal HA-epitope tag antibody 2-2.2.14 (Invitrogen, catalog no. 26183) was used for detection of hemagglutinin-tagged proteins (1:5000 dilution) ...
-
bioRxiv - Microbiology 2023Quote: ... The V5 epitope was detected with mouse mAb anti-V5 (Invitrogen; R96025). Toxoplasma-specific antibodies include mAb mouse anti-IMC1 [53] ...
-
bioRxiv - Cell Biology 2023Quote: ... The expression of epitopes was analyzed using Attune NxT flow cytometer (ThermoFisher).
-
bioRxiv - Microbiology 2024Quote: ... The V5 epitope was detected with mouse mAb anti-V5 (Invitrogen; R96025). Toxoplasma-specific antibodies include rabbit pAb anti-IMC6 (80) ...