Labshake search
Citations for Thermo Fisher :
451 - 500 of 5337 citations for TNF alpha TNFSF2 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Peritoneal Lavage cells were centrifuged at 1200 rpm for 5 min and resuspended in alpha MEM (Gibco; 12571063) media supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... The MUTZ-3 cell line (DSMZ, no ACC 295) was cultured in Minimum Essential Medium Alpha (MEMα) (Gibco, Thermo Fischer Scientific Cat# 22571020 ...
-
bioRxiv - Microbiology 2020Quote: ... we used human monoclonal antibodies produced recombinantly in human Expi293F cells (Life Technologies) as described before (Fang et al ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-human IgG-Alexa647 and anti-human IgG-Alexa568 were obtained from Invitrogen, anti-acetylated tubulin (T7451 ...
-
bioRxiv - Cell Biology 2020Quote: ... and human GAPDH and human KIF18A Taqman probes and primers (Thermo Fisher Scientific) were used for reverse transcription and qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and subjected to human total tau ELISA (human tau: # KHB0042, Thermo Fisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Biophysics 2021Quote: ... A stable HeLa Kyoto cell line expressing mEOS3.2-alpha tubulin and CENPA - GFP was generated and selected using puromycin and blasticidin (ThermoFisher) (Yu et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cell lines were cultured and maintained in MEM-alpha and RPMI 1640 containing 10% FBS (Gibco, Life Technologies) incubated at 37°C supplied with 5% CO2 ...
-
bioRxiv - Cell Biology 2020Quote: ... The freshly isolated mesenchymal stem cells were divided into two experimental groups respectively cultured in either Alpha-MEM (Gibco) supplemented with 20% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cell lines were cultured and maintained in MEM-alpha and RPMI 1640 containing 10% FBS (Gibco, Life Technologies) incubated at 37°C supplied with 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 FRT/TO CCNB1+/+ cell line was transfected with pcDNA5-FRT/TO-Cdk1-alpha-mScarlet and pOG44 (Invitrogen) using a 1:5 ratio ...
-
bioRxiv - Bioengineering 2019Quote: ... and the samples stained with 200 µL of 1:100 anti-alpha Tubulin primary antibody (Thermo Fisher Scientific, 322500) for 1 hour ...
-
bioRxiv - Neuroscience 2019Quote: Tissue from anonymized donors was received at 4°C in 1 ml “fibroblast medium” containing MEM alpha (Gibco, #12571), 10% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2021Quote: ... The membranes were incubated overnight with UCP1 antibody and loading control protein alpha tubulin antibody for the total protein adipose tissue samples (1:1.000 UCP1 Polyclonal Antibody, cat no. PA1-24894, 1:500 alpha Tubulin Polyclonal Antibody, cat no. PA5-16891, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: MyoD hiPS cells are seeded on 5µg/ml laminin-521-coated (Biolamina) in 5% KSR medium composed of Alpha-MEM (12571-063, Gibco), 5% KSR (10828028 ...
-
bioRxiv - Genomics 2021Quote: P19 embryonal carcinoma (EC) cells were maintained in the proliferation medium (minimum essential medium-alpha (MEMα; Thermo Fisher Scientific) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... ovaries were harvested and placed in HEPES-buffered alpha minimum essential medium (αMEM; Gibco, Life Technologies, New York, USA) supplemented with 3 mg/mL BSA (MP Biomedicals ...
-
bioRxiv - Developmental Biology 2022Quote: ... ovaries were harvested and placed in HEPES-buffered alpha minimum essential medium (αMEM; Gibco, Life Technologies, New York, USA) supplemented with 3 mg/mL BSA (MP Biomedicals ...
-
bioRxiv - Neuroscience 2022Quote: 2 mL screw cap tubes with conical bottom (Alpha Laboratories; CP5932) were filled with ribolysing beads (Fisher Scientific; 15515809) to cover the bevelled bottom of the tube and weighted ...
-
bioRxiv - Neuroscience 2023Quote: ... the interscutularis muscle was exposed and labeled with 5 µg/ml Alexa 647-conjugated alpha-bungarotoxin (ThermoFisher Scientific, USA) for 10 minutes at room temperature to stain acetylcholine receptors as a guide for neuromuscular junctions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tumour samples for PDX studies were transported to the laboratory in transport medium consisting of MEM alpha medium (Gibco) containing 1X penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Individual region-specific tumour samples were transported to the laboratory in transport medium consisting of MEM alpha medium (Gibco) containing 1X penicillin/streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... freshly isolated FAPs were cultured at 37L°C in alpha-MEM (Hyclone) supplemented with Antibiotic-Antimycotic (anti-anti, Gibco) and 20% FBS (Hyclone) ...
-
bioRxiv - Systems Biology 2023Quote: ... Each group was injected with either 1 M 13C6-glucose or 1 M 12C6-glucose (Acros Organics alpha-D(+) Glucose ...
-
bioRxiv - Developmental Biology 2023Quote: ... and the cell pellet was resuspended in Alpha Minimum Essential Medium (α-MEM; GIBCO BRL, Grand Island, NY, USA) supplemented with 15% (v/v ...
-
bioRxiv - Immunology 2024Quote: ... and allowed to incubate with a combination of Alexa Fluor 488-labeled anti-alpha smooth muscle actin antibody (Invitrogen/Thermo product # ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...