Labshake search
Citations for Thermo Fisher :
501 - 550 of 6633 citations for TMEM173 Human HEK293 Sumo His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: HEK293 cells were maintained in DMEM/F-12 (Gibco, cat no. 11320033) supplemented with 1% Penicillin-streptomycin (Gibco ...
-
bioRxiv - Biophysics 2023Quote: HEK293 cells were transfected with ICD constructs using Lipofectamine 2000 (Thermo Fisher) and were selected with G418 ...
-
bioRxiv - Cancer Biology 2024Quote: ... HEK293 cells were seeded overnight and transfected with Lipofectamine 3000 (Thermo Fisher) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: HEK293-6E suspension cells were cultured in FreeStyle F17 expression medium (Gibco) supplemented with 4 mM L-glutamine (Gibco) ...
-
bioRxiv - Biochemistry 2024Quote: HEK293 Freestyle suspension cells were cultured in HEK Freestyle Media (Invitrogen, 12338018) grown at 37° C in a humidified shaking platform incubator with 10% CO2 ...
-
bioRxiv - Bioengineering 2024Quote: HEK293-F suspension cells were cultured in FreeStyle 293 Expression Medium (Gibco) in shake flasks at 135 rpm ...
-
bioRxiv - Biochemistry 2024Quote: HEK293 cells (ATCC) were grown in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) with 10% fetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... fluorescence-labeled HIV-1JR-FL Env(-) carrying the (His)6 epitope tag was incubated with biotin-conjugated anti-(His)6 tag antibody (HIS.H8, Invitrogen) at 4° for two hours.
-
bioRxiv - Cell Biology 2019Quote: ... The plasmids encoding for His-SEPT2 or His-SEPT2-mCherry and SEPT6/7-strep were co-transformed into E.coli BL21 (DE3) (Invitrogen). Bacterial cultures were grown to OD600 of 2-3 and induced with 1 mM IPTG for 1h at 37°C (His-SEPT2 ...
-
bioRxiv - Immunology 2021Quote: ... RBD-His and Spike-his containing supernatants were batch purified using the HisPur™ Ni-NTA Resin (ThermoFisher Scientific). Supernatants were incubated with 6 ml of resin for 1h at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... Stable transformants of ZP161 expressing rat Pex14 variants tagged with N-terminal hexahistidine (His-Pex14) were isolated by transfection of pcDNAZeo-D/His-RnPEX14 variants (see below) followed by selection with Zeocin (Invitrogen), as described (Okumoto et al. ...
-
Lactic Acid Containing Polymers Produced in Engineered Sinorhizobium meliloti and Pseudomonas putidabioRxiv - Microbiology 2019Quote: ... the gel was used for His-tag staining following the InVision(tm) His-tag In-Gel Stain protocol provided by Invitrogen.
-
bioRxiv - Immunology 2022Quote: ... pAc5.1A/V5-His-CBF and pAc5.1A/V5-His-EF-1α were transfected into S2 cells using Cellfectin II Reagent (Invitrogen, USA), respectively ...
-
bioRxiv - Biochemistry 2020Quote: pRS1228 was constructed by amplifying sORF26 from pRS1209 using primers sORF26_1 rev (AAAAAATTAAGGATAATTTCCGTGCCTC) and sORF26_1 for (GTGCCTGTGATGAAAAATCTGGCTG) and TA-cloning the respective fragment into pET-SUMO (Invitrogen, Carlsbad, USA) vector ...
-
bioRxiv - Biochemistry 2022Quote: ... codon optimized full length human FMRP Isoform 1 cDNA was generated by gene synthesis (GeneScript, Inc) and was subcloned into a pET-SUMO vector (Invitrogen). This pET-SUMO-FMRP plasmid was used as a template to generate (i ...
-
bioRxiv - Cell Biology 2020Quote: ... His-tags were removed with AcTEV protease (Invitrogen) overnight and proteins further purified with a HiTrap SP HP cation exchange column (GE Healthcare).
-
bioRxiv - Molecular Biology 2020Quote: A pcDNA3.1/V5-His TOPO expression vector (Invitrogen) encoding the protein-coding sequence of human SM (NM_003129.4 ...
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-His antibody (Thermo Fisher, Waltham, MA) was diluted 1:2000 in 1x iBind solution ...
-
bioRxiv - Biochemistry 2020Quote: ... into pT7-N-His-GST (Thermo Fisher Scientific) or pET28a (EMD Millipore) ...
-
bioRxiv - Biophysics 2021Quote: ... supplemented with 10% HI-FBS (16140-071, Gibco), 100 U/mL Penicillin-Streptomycin (15140122 ...
-
bioRxiv - Biochemistry 2021Quote: ... then cloned into pIB/V5-His vector (Invitrogen), fused with V5 epitope at the C-terminus ...
-
bioRxiv - Biophysics 2020Quote: ... 10 % v/v Hi-Di formamide (Thermo Scientific), supplemented with 2 mM vanadyl ribonucleoside complex) ...
-
bioRxiv - Microbiology 2022Quote: ... and mouse anti His Alexa Fluor 555 (Invitrogen catalogue number MA1-135-A555 ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 % v/v Hi-Di formamide (Thermo Scientific), supplemented with 2 mM vanadyl ribonucleoside complex) ...
-
bioRxiv - Cell Biology 2019Quote: ... p38β (MAPK11, His-tagged, Thermo Fisher Scientific, #PV3679), p38γ (MAPK12 ...
-
bioRxiv - Cell Biology 2019Quote: ... p38γ (MAPK12, His-tagged Thermo Fisher Scientific, #PV3654), p38d (MAPK13 ...
-
bioRxiv - Cell Biology 2019Quote: ... p38d (MAPK13, His-tagged, Thermo Fisher Scientific, #PV3656) and hPI31 (UBPBio ...
-
bioRxiv - Cancer Biology 2020Quote: ... in 1X Hi-Fi PCR buffer (Invitrogen #52045) supplemented with 2 uL of 50 mM MgSO4 and dNTPs (Roche#11-581-295-001 ...
-
bioRxiv - Genetics 2021Quote: ... and Hi - Di™ Formamide (Applied Biosystems, USA). The DNA (PCR products ...
-
bioRxiv - Microbiology 2020Quote: ... MprA was detected using Anti-His antibody (Invitrogen) and anti-mouse HRP-labelled secondary antibody (Santa Cruz) ...
-
bioRxiv - Immunology 2022Quote: ... 10% hi-FBS and 1% penicillin/streptomycin (ThermoFisher) in absence or presence of APRIL (Recombinant Human APRIL/TNFSF13 Protein ...
-
bioRxiv - Microbiology 2022Quote: ... DMEM 2% Hi-FBS 0.5% Ultrapure agarose (Invitrogen) was used to overlay the wells ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse anti-His (Invitrogen, #MA1-21315, 1:1000), rabbit anti-GST (Merck,#ZRB1223,1:1000) ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 10% (v/v) HI-FBS (Gibco), 10 U/mL penicillin and 100 U/mL streptomycin (Corning) ...
-
bioRxiv - Microbiology 2023Quote: ... anti-6x-His mouse monoclonal (Invitrogen 37-2900), anti-CD99 mouse monoclonal (Invitrogen MA5-12954) ...
-
bioRxiv - Immunology 2023Quote: ... 6x His Tagged monoclonal antibody (Thermo Fisher Scientific) was also plated as an experimental control ...
-
bioRxiv - Biophysics 2023Quote: ... HRP-conjugated anti-His antibody (Invitrogen – Thermo Fisher), anti-H3 antibody (abcam ab1791 ...
-
bioRxiv - Biophysics 2023Quote: ... HRP-conjugated anti-His antibody (Invitrogen – Thermo Fisher), anti-H3 antibody (abcam ab1791 ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% (v/v) HI-FCS (Gibco), 50 μM mercaptoethanol (Sigma-Alrich) ...
-
bioRxiv - Genetics 2023Quote: ... 8.85 μl of HI-DI Formamide (Applied Biosystems), and the reaction mix was adjusted to 50 μl using ddH2O ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2% HI-FBS and 2mM EDTA (Invitrogen, 15575038).
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 10% Hi-FBS (Thermo Fisher Scientific). For VP4 expression ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid pBAD/Myc-His A (pBAD) (Invitrogen) and pET28a (+ ...
-
bioRxiv - Immunology 2024Quote: Dynabeads His-Tag Isolation and Pulldown beads (ThermoFisher) were washed once with Tris-buffered saline (TBS ...
-
bioRxiv - Biochemistry 2024Quote: C2C12 differentiation medium: DMEM Hi Glucose medium (Gibco) supplemented with 2% Horse Serum (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: Basal Conditioned medium: DMEM Hi Glucose medium (Gibco) supplemented with 1% Penicillin – Streptomycin – Glutamine (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: DMEM Starvation medium: DMEM Hi Glucose medium (Gibco) supplemented with 0.2%heat-inactivated fetal bovine serum (US origin ...
-
bioRxiv - Biochemistry 2024Quote: DMEM complete medium: DMEM Hi Glucose medium (Gibco) supplemented with 1% Penicillin – Streptomycin – Glutamine (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... anti-6*his tag (Thermo Fisher Scientific,11533923), anti-myc tag (Abcam ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: ... HEK293 and PLC/PRF/5 cells were cultured in MEM GlutaMAX™ (Gibco). All media were supplemented with 10% Fetal Bovine Serum (HyClone) ...