Labshake search
Citations for Thermo Fisher :
1 - 50 of 3080 citations for TIFAB siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... scrambled siRNA (NT siRNA) (Life Technologies) served as a negative control ...
-
bioRxiv - Molecular Biology 2021Quote: ... Rbfox2 siRNA (Invitrogen siRNA ID# s96620) or PTBP siRNAs (Qiagen cat# SI02649206 and SI04255146 ...
-
bioRxiv - Microbiology 2023Quote: siRNA targeting BicDR1 (Ambion siRNA #149588), Hook3 (Ambion siRNA #s228364 ...
-
bioRxiv - Neuroscience 2019Quote: ... Cldn5-targeting siRNA (Silencer® Pre-designed siRNA, siRNA ID: s64050, Ambion), Cldn12-targeting siRNA (Silencer® Pre-designed siRNA ...
-
bioRxiv - Neuroscience 2019Quote: ... Cldn12-targeting siRNA (Silencer® Pre-designed siRNA, siRNA ID: s82332, Ambion), Cldn19-targeting siRNA (Silencer® Pre-designed siRNA ...
-
bioRxiv - Neuroscience 2019Quote: ... Cldn19-targeting siRNA (Silencer® Pre-designed siRNA, siRNA ID: s202784, Ambion) or scrambled-siRNA-Cy3 (Mission®siRNA universal negative controls ...
-
bioRxiv - Neuroscience 2020Quote: siRNA targeting Cstb (Cstb siRNA) and scrambled siRNA (shuffled Cstb sequence) (Thermo Fisher) were used to transfect BV2 cells ...
-
bioRxiv - Neuroscience 2021Quote: ... or a control siRNA (Stealth siRNA, Invitrogen, USA) into SH-SY5Y cells with DharmaFECT (Dharmacon ...
-
bioRxiv - Developmental Biology 2022Quote: ... Creb5 siRNA (siRNA ID:s107062, 4390816, Thermo Fisher Scientific) and control siRNA (4390844 ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA against EFR3 was siRNA ID s94606 (ThermoFisher) and PI4K-IIIα siRNA ID s104706 (ThermoFisher).
-
bioRxiv - Bioengineering 2023Quote: ... siRNA alone (Stealth RNAi siRNA GFP, Thermo Fisher), siRNA-dMWCNT and incubated for 72-hours ...
-
bioRxiv - Genetics 2023Quote: ... siRNA targeting either WAPL (siRNA 148512, AM16708, ThermoFisher) or negative control (AllStars Negative Control siRNA ...
-
bioRxiv - Cancer Biology 2019Quote: SiRNA (Ambion, ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected with K8 scramble siRNA and K18 scramble siRNA or transfected with K8 siRNA and K18 siRNA using Lipofectamine 2000 (Invitrogen, CA, USA) according to the manufacturer’s instructions (Strnad et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Negative control siRNA (Scr, Ambion negative control siRNA 1) and siRNA against EDC4 (siEDC4 ...
-
bioRxiv - Molecular Biology 2021Quote: Control siRNA (#3 Dharmacon) or CNOT1 siRNA (Ambion no.S22844) was transfected using DharmaFECT 1 (2:1 ratio of siRNA to DharmaFECT 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... and APMAP siRNA (Silencer Select siRNA, Thermo Fisher s32757) with a final concentration of 10 nM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Control siRNA (MISSION® siRNA Universal Negative Control #1) and Flotillin-2 siRNA (Thermo Fisher 122408) were used.
-
bioRxiv - Immunology 2023Quote: ... Scrambled siRNA or targeted siRNA (Dharmacon ON-TARGETplus SMARTpool siRNA) in Opti-MEM reduced-serum medium (Gibco) was transfected at a final concentration of 50 nM with Lipofectamine RNAiMAX (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... A non-targeting scrambled siRNA (Silencer negative control siRNA, Ambion) was used as a control.
-
bioRxiv - Immunology 2021Quote: ... The siRNAs targeting DDX18 or the negative control siRNA (Invitrogen) were transfected at a working concentration of 50 nM ...
-
bioRxiv - Physiology 2020Quote: ... or control siRNA (non-targeting negative control siRNA; Invitrogen, 4390843) at 10 nmol/L ...
-
bioRxiv - Cell Biology 2020Quote: The following siRNAs were used: Silencer Select siRNA (Life Technologies) against CEP57 (s18692) ...
-
bioRxiv - Neuroscience 2021Quote: All siRNA were purchased from Accell smartpool siRNA (Thermo Scientific), following the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... The control siRNA and a pool of TAX1BP1 siRNA (Ambion) were used for TAX1BP1 silencing experiments.
-
bioRxiv - Molecular Biology 2022Quote: ... or custom siRNAs targeting S1P (Silencer Select siRNAs, Life Technologies) using Lipofectamine RNAiMAX as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: All siRNA were purchased from Accell smartpool siRNA (Thermo Scientific), following the manufacturers protocol ...
-
bioRxiv - Genomics 2023Quote: The following siRNAs were used: Silencer Select siRNA (Life Technologies) against POLQ no.1 (s21059) ...
-
bioRxiv - Cancer Biology 2023Quote: siRNA products were purchased from Thermo Fisher (Silencer Select siRNA). The specific products used were ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNAs used in this study are: RBM10 siRNA #1 (ThermoFisher Scientific HSS112075 ...
-
bioRxiv - Microbiology 2021Quote: ... siRNAs from Ambion were used for A1S (siRNA ID ...
-
bioRxiv - Molecular Biology 2020Quote: ... and siRNAs (Invitrogen) (sequences provided in Supplemental Table 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... siRNA scrambled: (Ambion), siRNA HIF-1α (target sequence ...
-
bioRxiv - Neuroscience 2021Quote: ... siRNA(−) (ThermoFisher Scientific). For transfection ...
-
bioRxiv - Biophysics 2021Quote: Stealth siRNA (Invitrogen) targeting IRSp53 (BA-IAP2 ...
-
bioRxiv - Cell Biology 2022Quote: ... siRNA SRSF7 (Invitrogen) or a negative scrambled control (IDT) ...
-
bioRxiv - Cell Biology 2020Quote: ... control siRNA (Ambion). Expression plasmids were transfected in HeLa and YFP-Parkin HeLa using Xtreme Gene 9 (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA oligos (Ambion, Life Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNAs (Thermo Fisher) used include ...
-
bioRxiv - Microbiology 2023Quote: ... siRNAs from Ambion were used (catalog no ...
-
bioRxiv - Cancer Biology 2023Quote: ... siRNAs from Ambion Life Technologies were as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 siRNA (Ambion), using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... or experimental siRNAs (single siRNAs or siRNA pools – see Key Resources) using the standard Lipofectamine 2000 (Invitrogen, 11668027) manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: The scrambled siRNA or the specific VEGFR siRNA (VEGFR-1-VEGFR-2 siRNA, Ambion Life Technologies, Monza, Italy) were intrathecally (i.t. ...
-
bioRxiv - Neuroscience 2021Quote: The scrambled siRNA or the specific VEGFR siRNA (VEGFR-1-VEGFR-2 siRNA, Ambion Life Technologies, Monza, Italy) were intrathecally (i.t. ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA oligos (Ambion, Life Technologies; siRNA ID #s s18158 and s18160) were transfected with Lipofectamine 3000 twice ...
-
bioRxiv - Cell Biology 2022Quote: ... Human NGFR siRNA or negative control siRNA were obtained from ThermoFisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2021Quote: ... 300 nM Slc37a2 siRNAs or Silencer™ negative control siRNA (Ambion) was added to the solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... ERO1lα siRNA (HSS121196) or non-targeted control (NTC) siRNA (Thermofisher Scientific) were transfected using the lipofectamine RNAiMAX reverse transfection method (Thermofisher Sientific ...